Incidental Mutation 'R7643:Uckl1'
ID590335
Institutional Source Beutler Lab
Gene Symbol Uckl1
Ensembl Gene ENSMUSG00000089917
Gene Nameuridine-cytidine kinase 1-like 1
SynonymsUrkl1, 1110007H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181569149-181584892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 181573106 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 292 (I292V)
Ref Sequence ENSEMBL: ENSMUSP00000050398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]
Predicted Effect probably benign
Transcript: ENSMUST00000057816
AA Change: I292V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: I292V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129469
AA Change: I292V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917
AA Change: I292V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect probably benign
Transcript: ENSMUST00000134340
SMART Domains Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:UPRTase 1 182 9.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136875
SMART Domains Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:CPT 83 211 2.3e-10 PFAM
Pfam:AAA_17 85 235 4.9e-9 PFAM
Pfam:PRK 85 235 8.4e-47 PFAM
Pfam:AAA_18 86 235 2.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154613
AA Change: I8V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Uckl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Uckl1 APN 2 181569617 missense probably benign 0.09
IGL01128:Uckl1 APN 2 181570337 missense probably damaging 1.00
IGL01325:Uckl1 APN 2 181574961 nonsense probably null
IGL01767:Uckl1 APN 2 181569534 missense probably damaging 1.00
IGL02260:Uckl1 APN 2 181569588 missense probably damaging 1.00
IGL02390:Uckl1 APN 2 181574419 missense possibly damaging 0.59
IGL03369:Uckl1 APN 2 181570189 missense probably benign 0.00
R0001:Uckl1 UTSW 2 181574655 missense probably damaging 1.00
R0528:Uckl1 UTSW 2 181570490 splice site probably benign
R1037:Uckl1 UTSW 2 181572485 missense possibly damaging 0.67
R1355:Uckl1 UTSW 2 181573376 missense probably damaging 1.00
R1416:Uckl1 UTSW 2 181569569 missense possibly damaging 0.79
R1435:Uckl1 UTSW 2 181573133 missense probably benign 0.01
R1676:Uckl1 UTSW 2 181574918 missense probably damaging 1.00
R1723:Uckl1 UTSW 2 181570600 critical splice acceptor site probably null
R1954:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R1955:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R3972:Uckl1 UTSW 2 181574463 missense probably damaging 0.98
R4664:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R4666:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R5306:Uckl1 UTSW 2 181574367 critical splice donor site probably null
R5751:Uckl1 UTSW 2 181574452 missense possibly damaging 0.81
R5758:Uckl1 UTSW 2 181569953 missense probably damaging 1.00
R6174:Uckl1 UTSW 2 181573073 critical splice donor site probably null
R6662:Uckl1 UTSW 2 181573260 missense possibly damaging 0.87
R6865:Uckl1 UTSW 2 181574493 missense probably damaging 1.00
R7051:Uckl1 UTSW 2 181574244 missense probably damaging 1.00
R7818:Uckl1 UTSW 2 181574667 missense probably damaging 0.97
R8094:Uckl1 UTSW 2 181573256 missense probably damaging 1.00
R8341:Uckl1 UTSW 2 181569719 missense probably benign 0.00
R8515:Uckl1 UTSW 2 181574487 missense probably damaging 1.00
RF014:Uckl1 UTSW 2 181570194 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTAGCCTTCCAAGCATG -3'
(R):5'- CAGTACAACAAGTTTGTCAAACCTG -3'

Sequencing Primer
(F):5'- GCCTATTGCAGAGGGCTG -3'
(R):5'- GCATTTGATCAGTATATCCAGCC -3'
Posted On2019-10-24