Incidental Mutation 'R7643:Gon4l'
ID590336
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88902807 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1774 (D1774E)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107494] [ENSMUST00000107498]
Predicted Effect probably damaging
Transcript: ENSMUST00000081695
AA Change: D1774E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: D1774E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090942
AA Change: D1775E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: D1775E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107494
SMART Domains Protein: ENSMUSP00000103118
Gene: ENSMUSG00000068922

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Pfam:Tubulin_3 153 345 5.3e-28 PFAM
Pfam:Tubulin 169 300 7.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107498
AA Change: D1774E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: D1774E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Meta Mutation Damage Score 0.1283 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 splice site probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
R7635:Gon4l UTSW 3 88895106 missense probably benign 0.03
R7715:Gon4l UTSW 3 88908006 missense probably benign
R7773:Gon4l UTSW 3 88895795 missense probably benign 0.00
R8090:Gon4l UTSW 3 88892624 missense probably damaging 1.00
R8224:Gon4l UTSW 3 88895142 missense probably damaging 1.00
R8260:Gon4l UTSW 3 88892630 missense probably damaging 0.98
R8434:Gon4l UTSW 3 88854779 missense probably damaging 1.00
Z1177:Gon4l UTSW 3 88859036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTTCCAAGGCACACAGTG -3'
(R):5'- TCAAACTAAATGAGAGTTGGTGGC -3'

Sequencing Primer
(F):5'- GCCAAGCCTGAATACCTGAGTTTG -3'
(R):5'- CAGTGAGTAGACTTGGGGATCC -3'
Posted On2019-10-24