Incidental Mutation 'R0234:Zfp27'
ID59034
Institutional Source Beutler Lab
Gene Symbol Zfp27
Ensembl Gene ENSMUSG00000062040
Gene Namezinc finger protein 27
Synonymsmkr-4, Zfp-27
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.563) question?
Stock #R0234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29893333-29906572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29894107 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 811 (H811L)
Ref Sequence ENSEMBL: ENSMUSP00000127677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053521] [ENSMUST00000159920] [ENSMUST00000161904] [ENSMUST00000162592] [ENSMUST00000172448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053521
AA Change: H811L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000054012
Gene: ENSMUSG00000062040
AA Change: H811L

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159920
AA Change: H811L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125232
Gene: ENSMUSG00000062040
AA Change: H811L

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161904
AA Change: H811L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124684
Gene: ENSMUSG00000062040
AA Change: H811L

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162592
AA Change: H811L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123953
Gene: ENSMUSG00000062040
AA Change: H811L

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172448
AA Change: H811L

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127677
Gene: ENSMUSG00000062040
AA Change: H811L

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Zfp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Zfp27 APN 7 29894958 missense probably damaging 0.97
IGL02490:Zfp27 APN 7 29894935 missense possibly damaging 0.73
IGL02899:Zfp27 APN 7 29896255 missense possibly damaging 0.91
R0179:Zfp27 UTSW 7 29896425 missense possibly damaging 0.51
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0511:Zfp27 UTSW 7 29894522 missense probably damaging 0.97
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1294:Zfp27 UTSW 7 29896312 missense possibly damaging 0.53
R1581:Zfp27 UTSW 7 29896124 missense possibly damaging 0.53
R1763:Zfp27 UTSW 7 29895376 missense possibly damaging 0.96
R2083:Zfp27 UTSW 7 29894783 missense probably benign 0.06
R2217:Zfp27 UTSW 7 29896111 missense possibly damaging 0.96
R2696:Zfp27 UTSW 7 29896367 missense possibly damaging 0.85
R4084:Zfp27 UTSW 7 29895367 missense possibly damaging 0.91
R4864:Zfp27 UTSW 7 29894836 missense probably damaging 0.99
R6057:Zfp27 UTSW 7 29895019 missense possibly damaging 0.83
R6063:Zfp27 UTSW 7 29894302 missense probably damaging 0.97
R6553:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6585:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6800:Zfp27 UTSW 7 29894435 missense probably benign 0.19
R7051:Zfp27 UTSW 7 29895021 small deletion probably benign
R7052:Zfp27 UTSW 7 29895021 small deletion probably benign
R7066:Zfp27 UTSW 7 29895021 small deletion probably benign
R7106:Zfp27 UTSW 7 29895021 small deletion probably benign
R7432:Zfp27 UTSW 7 29895359 missense probably benign 0.33
R7473:Zfp27 UTSW 7 29895899 missense possibly damaging 0.71
R7670:Zfp27 UTSW 7 29894796 missense possibly damaging 0.94
R7739:Zfp27 UTSW 7 29894274 missense possibly damaging 0.93
R7817:Zfp27 UTSW 7 29896390 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGCAAGTAGAAATGTCCTGCCCC -3'
(R):5'- AGTCCTTCAGGCAGAAGTCAGAGC -3'

Sequencing Primer
(F):5'- GTAGAAATGTCCTGCCCCATAATC -3'
(R):5'- tcactaagaaatcccagctcc -3'
Posted On2013-07-11