Incidental Mutation 'R7643:Zscan4e'
ID590348
Institutional Source Beutler Lab
Gene Symbol Zscan4e
Ensembl Gene ENSMUSG00000095936
Gene Namezinc finger and SCAN domain containing 4E
SynonymsEG665848
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7643 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location11306378-11310682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11309525 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 108 (M108K)
Ref Sequence ENSEMBL: ENSMUSP00000147491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166753] [ENSMUST00000210521]
Predicted Effect probably damaging
Transcript: ENSMUST00000166753
AA Change: M108K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125906
Gene: ENSMUSG00000095936
AA Change: M108K

DomainStartEndE-ValueType
Pfam:SCAN 43 122 5e-17 PFAM
low complexity region 181 192 N/A INTRINSIC
ZnF_C2H2 394 416 2.75e-3 SMART
ZnF_C2H2 423 445 6.57e-1 SMART
ZnF_C2H2 451 473 7.26e-3 SMART
ZnF_C2H2 479 502 3.83e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166753
AA Change: M108K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210521
AA Change: M108K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Other mutations in Zscan4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03210:Zscan4e APN 7 11307532 missense probably benign 0.02
R0295:Zscan4e UTSW 7 11307616 missense probably damaging 1.00
R4105:Zscan4e UTSW 7 11307510 missense probably benign 0.01
R4645:Zscan4e UTSW 7 11307075 missense possibly damaging 0.76
R7308:Zscan4e UTSW 7 11307153 missense probably benign
R7371:Zscan4e UTSW 7 11307324 missense probably benign
R7396:Zscan4e UTSW 7 11307075 missense probably benign 0.27
R7767:Zscan4e UTSW 7 11307534 missense probably damaging 0.98
R8307:Zscan4e UTSW 7 11307132 missense probably benign 0.41
R8465:Zscan4e UTSW 7 11307651 missense probably damaging 1.00
R8694:Zscan4e UTSW 7 11307647 missense possibly damaging 0.90
R8813:Zscan4e UTSW 7 11307613 nonsense probably null
Z1176:Zscan4e UTSW 7 11306979 missense probably damaging 1.00
Z1177:Zscan4e UTSW 7 11307625 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGTCTCGCACACAAGTTATCTC -3'
(R):5'- TCAGGAGCTGCAAAGTCTCTG -3'

Sequencing Primer
(F):5'- CTAGACTTAGTTGTGCATATCAAACC -3'
(R):5'- AGTCTCTGGAAGATGTTCAACTCCTG -3'
Posted On2019-10-24