Incidental Mutation 'R0234:Lsm14a'
Institutional Source Beutler Lab
Gene Symbol Lsm14a
Ensembl Gene ENSMUSG00000066568
Gene NameLSM14A mRNA processing body assembly factor
SynonymsTral, 2700023B17Rik
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R0234 (G1)
Quality Score219
Status Not validated
Chromosomal Location34344646-34393315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34365617 bp
Amino Acid Change Glutamine to Arginine at position 179 (Q179R)
Ref Sequence ENSEMBL: ENSMUSP00000082723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085585] [ENSMUST00000133046] [ENSMUST00000155256] [ENSMUST00000206388]
Predicted Effect probably damaging
Transcript: ENSMUST00000085585
AA Change: Q179R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082723
Gene: ENSMUSG00000066568
AA Change: Q179R

LSM14 1 98 1.15e-57 SMART
low complexity region 129 140 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
FDF 289 399 6.14e-35 SMART
low complexity region 403 428 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133046
AA Change: Q143R
SMART Domains Protein: ENSMUSP00000119461
Gene: ENSMUSG00000066568
AA Change: Q143R

LSM14 1 62 1.33e-12 SMART
low complexity region 93 104 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155256
AA Change: Q179R
SMART Domains Protein: ENSMUSP00000118766
Gene: ENSMUSG00000066568
AA Change: Q179R

LSM14 1 98 1.15e-57 SMART
low complexity region 129 140 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
Pfam:FDF 230 287 7.5e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000205519
AA Change: Q69R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205645
Predicted Effect probably benign
Transcript: ENSMUST00000206388
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Lsm14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lsm14a APN 7 34389355 intron probably benign
IGL02259:Lsm14a APN 7 34371133 missense probably damaging 1.00
IGL02940:Lsm14a APN 7 34371171 nonsense probably null
R0234:Lsm14a UTSW 7 34365617 missense probably damaging 1.00
R0826:Lsm14a UTSW 7 34371045 splice site probably benign
R1344:Lsm14a UTSW 7 34353557 missense probably damaging 1.00
R1641:Lsm14a UTSW 7 34351374 missense probably damaging 0.99
R1667:Lsm14a UTSW 7 34365654 missense possibly damaging 0.93
R2135:Lsm14a UTSW 7 34371184 missense probably damaging 1.00
R2331:Lsm14a UTSW 7 34357490 missense probably benign
R3709:Lsm14a UTSW 7 34353779 missense probably damaging 0.99
R3710:Lsm14a UTSW 7 34353779 missense probably damaging 0.99
R4304:Lsm14a UTSW 7 34357433 critical splice donor site probably null
R4998:Lsm14a UTSW 7 34375374 missense probably damaging 1.00
R5304:Lsm14a UTSW 7 34353729 missense possibly damaging 0.58
R5383:Lsm14a UTSW 7 34389364 missense possibly damaging 0.48
R5639:Lsm14a UTSW 7 34353510 missense probably damaging 1.00
R6370:Lsm14a UTSW 7 34357481 missense probably benign 0.17
R7443:Lsm14a UTSW 7 34353838 missense probably benign
R7559:Lsm14a UTSW 7 34353401 nonsense probably null
R7812:Lsm14a UTSW 7 34388876 intron probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cctaagataaccagtgaaacccc -3'
Posted On2013-07-11