Incidental Mutation 'R7643:Nup93'
ID 590355
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
MMRRC Submission 045700-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R7643 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 94214564-94317227 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94286619 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212167] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably null
Transcript: ENSMUST00000079961
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109547
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211822
Predicted Effect probably benign
Transcript: ENSMUST00000212167
Predicted Effect probably null
Transcript: ENSMUST00000212824
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A G 9: 15,297,860 (GRCm38) F46S probably damaging Het
Acaca T C 11: 84,338,356 (GRCm38) Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 (GRCm38) R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 (GRCm38) Q1050L probably benign Het
Amn1 C T 6: 149,185,031 (GRCm38) M44I probably benign Het
Ankrd13b A G 11: 77,473,085 (GRCm38) V395A probably benign Het
Ap3b2 T C 7: 81,477,072 (GRCm38) K310R probably benign Het
Bnc2 T C 4: 84,506,574 (GRCm38) D123G probably benign Het
Bst1 G A 5: 43,840,449 (GRCm38) M263I probably benign Het
Ccdc7a C T 8: 128,889,811 (GRCm38) G937E probably damaging Het
Cep290 A G 10: 100,537,553 (GRCm38) M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 (GRCm38) Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 (GRCm38) H1203L probably benign Het
Emc7 A G 2: 112,455,279 (GRCm38) E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 (GRCm38) probably benign Het
Fam83c A G 2: 155,831,004 (GRCm38) F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 (GRCm38) V180L probably benign Het
Gbp2b G T 3: 142,603,609 (GRCm38) Q160H probably benign Het
Gm19965 C G 1: 116,822,229 (GRCm38) Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 (GRCm38) probably benign Het
Gon4l T A 3: 88,902,807 (GRCm38) D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 (GRCm38) Y303* probably null Het
Greb1 T C 12: 16,711,996 (GRCm38) D461G probably damaging Het
Gria4 T C 9: 4,793,950 (GRCm38) N36S probably benign Het
Hacd1 T C 2: 14,044,791 (GRCm38) I119V probably damaging Het
Ing5 T A 1: 93,812,433 (GRCm38) D101E probably damaging Het
Irak4 T A 15: 94,558,828 (GRCm38) N297K probably benign Het
Itga7 A G 10: 128,953,501 (GRCm38) D971G probably benign Het
Klf5 A G 14: 99,313,178 (GRCm38) E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 (GRCm38) G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 (GRCm38) probably null Het
Marchf4 T G 1: 72,447,220 (GRCm38) Q266H probably damaging Het
Med23 A G 10: 24,905,965 (GRCm38) T1056A probably benign Het
Megf11 T C 9: 64,706,632 (GRCm38) L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 (GRCm38) L85I probably benign Het
Nlgn2 G T 11: 69,827,885 (GRCm38) Q290K probably damaging Het
Nox4 A T 7: 87,323,754 (GRCm38) E323V probably damaging Het
Olfr977-ps1 T A 9: 39,974,821 (GRCm38) M1L unknown Het
Or14a257 C T 7: 86,489,568 (GRCm38) probably null Het
Or51e1 C T 7: 102,709,538 (GRCm38) T93I probably benign Het
Otop3 T C 11: 115,339,648 (GRCm38) L117P probably damaging Het
Pde6c C A 19: 38,141,421 (GRCm38) Q260K probably damaging Het
Plb1 C T 5: 32,247,557 (GRCm38) Q20* probably null Het
Qser1 A T 2: 104,786,977 (GRCm38) Y1163* probably null Het
Rbm12 A T 2: 156,098,217 (GRCm38) I45N unknown Het
Rictor T A 15: 6,769,269 (GRCm38) Y332* probably null Het
Rpp14 C A 14: 8,090,325 (GRCm38) S83* probably null Het
Sel1l3 C T 5: 53,123,162 (GRCm38) probably null Het
Setd2 T C 9: 110,567,840 (GRCm38) probably null Het
Spink5 A G 18: 44,010,252 (GRCm38) T759A probably benign Het
Spon2 T A 5: 33,217,456 (GRCm38) E2V probably benign Het
Tdrd1 T C 19: 56,837,708 (GRCm38) S144P probably damaging Het
Tex15 A C 8: 33,575,120 (GRCm38) Y1526S probably damaging Het
Tex55 A G 16: 38,827,863 (GRCm38) Y295H probably benign Het
Tnfrsf21 T C 17: 43,037,916 (GRCm38) S140P probably benign Het
Trav6-2 T A 14: 52,667,442 (GRCm38) M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 (GRCm38) probably null Het
Ttn T C 2: 76,734,827 (GRCm38) N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 (GRCm38) I292V probably benign Het
Unc13b T A 4: 43,216,333 (GRCm38) S211T probably benign Het
Zcchc4 T C 5: 52,808,293 (GRCm38) I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 (GRCm38) R1811K probably benign Het
Zfp599 G T 9: 22,249,892 (GRCm38) Q326K probably benign Het
Zscan4e A T 7: 11,309,525 (GRCm38) M108K probably damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 94,309,023 (GRCm38) critical splice donor site probably null
IGL01652:Nup93 APN 8 94,296,559 (GRCm38) missense possibly damaging 0.93
IGL02003:Nup93 APN 8 94,302,109 (GRCm38) nonsense probably null
IGL02169:Nup93 APN 8 94,302,129 (GRCm38) missense probably damaging 1.00
IGL02212:Nup93 APN 8 94,311,662 (GRCm38) critical splice donor site probably null
IGL02551:Nup93 APN 8 94,227,833 (GRCm38) nonsense probably null
IGL02568:Nup93 APN 8 94,309,635 (GRCm38) missense probably damaging 1.00
IGL03094:Nup93 APN 8 94,296,502 (GRCm38) missense probably benign
IGL03248:Nup93 APN 8 94,306,088 (GRCm38) missense probably damaging 0.98
IGL03273:Nup93 APN 8 94,306,277 (GRCm38) missense probably benign 0.01
IGL03401:Nup93 APN 8 94,309,711 (GRCm38) splice site probably null
PIT4585001:Nup93 UTSW 8 94,243,727 (GRCm38) missense probably benign 0.25
R0409:Nup93 UTSW 8 94,303,665 (GRCm38) missense probably damaging 1.00
R0748:Nup93 UTSW 8 94,307,943 (GRCm38) missense probably damaging 1.00
R0891:Nup93 UTSW 8 94,281,263 (GRCm38) splice site probably benign
R1667:Nup93 UTSW 8 94,292,687 (GRCm38) missense possibly damaging 0.71
R1696:Nup93 UTSW 8 94,296,555 (GRCm38) missense probably benign 0.29
R1862:Nup93 UTSW 8 94,306,102 (GRCm38) missense probably damaging 1.00
R2069:Nup93 UTSW 8 94,243,739 (GRCm38) missense probably damaging 1.00
R2143:Nup93 UTSW 8 94,296,480 (GRCm38) nonsense probably null
R2187:Nup93 UTSW 8 94,300,850 (GRCm38) missense probably damaging 1.00
R2228:Nup93 UTSW 8 94,304,191 (GRCm38) missense probably benign 0.27
R2229:Nup93 UTSW 8 94,304,191 (GRCm38) missense probably benign 0.27
R2254:Nup93 UTSW 8 94,227,857 (GRCm38) critical splice donor site probably null
R2884:Nup93 UTSW 8 94,303,638 (GRCm38) missense probably damaging 1.00
R4521:Nup93 UTSW 8 94,314,636 (GRCm38) missense probably damaging 1.00
R4563:Nup93 UTSW 8 94,307,892 (GRCm38) missense probably damaging 1.00
R4900:Nup93 UTSW 8 94,286,603 (GRCm38) missense probably benign 0.25
R5570:Nup93 UTSW 8 94,314,670 (GRCm38) missense probably damaging 1.00
R6226:Nup93 UTSW 8 94,286,537 (GRCm38) missense probably damaging 1.00
R6489:Nup93 UTSW 8 94,302,088 (GRCm38) missense probably benign 0.10
R6658:Nup93 UTSW 8 94,304,179 (GRCm38) missense probably benign 0.02
R6817:Nup93 UTSW 8 94,314,682 (GRCm38) critical splice donor site probably null
R6895:Nup93 UTSW 8 94,243,686 (GRCm38) missense probably damaging 1.00
R6955:Nup93 UTSW 8 94,309,673 (GRCm38) missense probably damaging 0.96
R7476:Nup93 UTSW 8 94,303,632 (GRCm38) missense probably damaging 1.00
R7994:Nup93 UTSW 8 94,306,302 (GRCm38) missense probably benign 0.15
R8461:Nup93 UTSW 8 94,281,335 (GRCm38) critical splice donor site probably null
R9177:Nup93 UTSW 8 94,227,743 (GRCm38) missense probably benign 0.25
R9264:Nup93 UTSW 8 94,292,720 (GRCm38) missense probably benign 0.01
R9532:Nup93 UTSW 8 94,314,621 (GRCm38) missense probably damaging 1.00
R9567:Nup93 UTSW 8 94,308,976 (GRCm38) missense possibly damaging 0.94
R9629:Nup93 UTSW 8 94,306,639 (GRCm38) missense probably damaging 0.99
R9721:Nup93 UTSW 8 94,303,685 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAACCAAAGTCACTGGGTC -3'
(R):5'- AAGAAGTGATGACCTACAGACTAC -3'

Sequencing Primer
(F):5'- ACCAAAGTCACTGGGTCTGCTC -3'
(R):5'- TATCAGGAGAGAGGGTGTTTTAAG -3'
Posted On 2019-10-24