Incidental Mutation 'R7643:Zfp599'
ID 590359
Institutional Source Beutler Lab
Gene Symbol Zfp599
Ensembl Gene ENSMUSG00000062794
Gene Name zinc finger protein 599
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7643 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22247430-22259895 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 22249892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 326 (Q326K)
Ref Sequence ENSEMBL: ENSMUSP00000083462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086281]
AlphaFold E9PWP1
Predicted Effect probably benign
Transcript: ENSMUST00000086281
AA Change: Q326K

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000083462
Gene: ENSMUSG00000062794
AA Change: Q326K

DomainStartEndE-ValueType
KRAB 4 64 5.35e-33 SMART
ZnF_C2H2 228 250 5.59e-4 SMART
ZnF_C2H2 256 278 2.43e-4 SMART
ZnF_C2H2 284 306 1.69e-3 SMART
ZnF_C2H2 312 334 8.94e-3 SMART
ZnF_C2H2 340 362 8.47e-4 SMART
ZnF_C2H2 368 390 5.06e-2 SMART
ZnF_C2H2 396 418 7.9e-4 SMART
ZnF_C2H2 424 446 7.67e-2 SMART
ZnF_C2H2 452 474 1.64e-1 SMART
ZnF_C2H2 480 503 7.37e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Zfp599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Zfp599 APN 9 22249472 missense possibly damaging 0.94
IGL00845:Zfp599 APN 9 22251518 splice site probably benign
R0136:Zfp599 UTSW 9 22249742 missense probably benign 0.13
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0421:Zfp599 UTSW 9 22250547 splice site probably benign
R1699:Zfp599 UTSW 9 22250404 missense probably benign 0.20
R1723:Zfp599 UTSW 9 22258065 missense probably damaging 1.00
R1899:Zfp599 UTSW 9 22251549 missense probably benign 0.00
R4231:Zfp599 UTSW 9 22249745 nonsense probably null
R4233:Zfp599 UTSW 9 22249745 nonsense probably null
R4236:Zfp599 UTSW 9 22249745 nonsense probably null
R4931:Zfp599 UTSW 9 22258123 missense probably damaging 0.98
R5117:Zfp599 UTSW 9 22250100 nonsense probably null
R5615:Zfp599 UTSW 9 22253869 missense probably benign
R5759:Zfp599 UTSW 9 22249661 missense probably damaging 1.00
R5915:Zfp599 UTSW 9 22249834 missense probably damaging 1.00
R6184:Zfp599 UTSW 9 22249651 missense probably benign 0.18
R6188:Zfp599 UTSW 9 22249990 missense probably damaging 1.00
R6657:Zfp599 UTSW 9 22250242 missense probably damaging 1.00
R6736:Zfp599 UTSW 9 22249844 missense probably damaging 1.00
R6752:Zfp599 UTSW 9 22249544 missense probably damaging 1.00
R7071:Zfp599 UTSW 9 22258096 missense probably benign 0.38
R7714:Zfp599 UTSW 9 22250515 missense probably benign 0.07
R7951:Zfp599 UTSW 9 22249468 missense probably damaging 1.00
R7967:Zfp599 UTSW 9 22249534 missense possibly damaging 0.66
R8014:Zfp599 UTSW 9 22249481 missense probably benign 0.03
R8187:Zfp599 UTSW 9 22249815 nonsense probably null
R9562:Zfp599 UTSW 9 22249703 missense probably damaging 0.98
R9684:Zfp599 UTSW 9 22249528 missense probably damaging 1.00
R9722:Zfp599 UTSW 9 22249445 missense probably damaging 0.96
RF005:Zfp599 UTSW 9 22253884 missense probably benign 0.03
RF024:Zfp599 UTSW 9 22253884 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTTGATGTCGAATGAGGTGTGAC -3'
(R):5'- TCTGCTCTCAGGGAAAACTTACTC -3'

Sequencing Primer
(F):5'- CACAGTCTGTGCATGCATAAG -3'
(R):5'- CAGAATGTGGGAAAGCCTTTTC -3'
Posted On 2019-10-24