Incidental Mutation 'R7643:Megf11'
ID590361
Institutional Source Beutler Lab
Gene Symbol Megf11
Ensembl Gene ENSMUSG00000036466
Gene Namemultiple EGF-like-domains 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64385626-64709205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64706632 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1079 (L1079P)
Ref Sequence ENSEMBL: ENSMUSP00000128672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068967] [ENSMUST00000118485] [ENSMUST00000164113]
Predicted Effect probably benign
Transcript: ENSMUST00000068967
SMART Domains Protein: ENSMUSP00000065353
Gene: ENSMUSG00000036466

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118485
AA Change: L1026P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114035
Gene: ENSMUSG00000036466
AA Change: L1026P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF 704 736 8.52e0 SMART
EGF_Lam 752 791 2.99e-4 SMART
EGF 790 822 1.14e0 SMART
transmembrane domain 848 870 N/A INTRINSIC
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164113
AA Change: L1079P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128672
Gene: ENSMUSG00000036466
AA Change: L1079P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 74 84 N/A INTRINSIC
EGF 101 129 1.85e0 SMART
EGF_Lam 145 184 9.55e-3 SMART
EGF_Lam 188 227 2e-5 SMART
EGF 226 258 5.57e-4 SMART
EGF_Lam 274 313 1.26e-2 SMART
EGF_Lam 317 357 2.52e-2 SMART
EGF_Lam 361 402 4.16e-3 SMART
EGF 401 433 6.21e-2 SMART
EGF 444 476 4.1e-2 SMART
EGF 487 519 7.02e-1 SMART
EGF_Lam 535 574 1.43e-1 SMART
EGF_Lam 578 617 5.04e-2 SMART
EGF 616 650 8.52e0 SMART
EGF 661 693 9.41e-2 SMART
EGF_Lam 709 748 2.99e-4 SMART
EGF 747 779 1.14e0 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of horizontal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Megf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Megf11 APN 9 64508727 missense probably damaging 1.00
IGL01285:Megf11 APN 9 64660446 missense probably damaging 1.00
IGL01309:Megf11 APN 9 64681416 missense probably benign 0.01
IGL01953:Megf11 APN 9 64690088 missense probably damaging 1.00
IGL02341:Megf11 APN 9 64544620 missense probably damaging 1.00
IGL02407:Megf11 APN 9 64680249 missense probably damaging 1.00
IGL02621:Megf11 APN 9 64693932 missense probably benign 0.07
R0277:Megf11 UTSW 9 64691350 critical splice donor site probably null
R0386:Megf11 UTSW 9 64640078 missense probably damaging 1.00
R1354:Megf11 UTSW 9 64653177 missense probably benign 0.00
R1709:Megf11 UTSW 9 64695412 missense probably damaging 1.00
R1865:Megf11 UTSW 9 64680299 missense probably benign 0.39
R1895:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R1946:Megf11 UTSW 9 64679276 missense probably damaging 1.00
R2221:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R2223:Megf11 UTSW 9 64660431 missense possibly damaging 0.63
R3552:Megf11 UTSW 9 64695463 missense possibly damaging 0.75
R4641:Megf11 UTSW 9 64690125 missense possibly damaging 0.93
R4746:Megf11 UTSW 9 64508745 missense probably damaging 1.00
R5594:Megf11 UTSW 9 64686473 missense probably damaging 1.00
R5716:Megf11 UTSW 9 64506110 missense possibly damaging 0.72
R5898:Megf11 UTSW 9 64685964 missense probably damaging 1.00
R5960:Megf11 UTSW 9 64660449 missense probably benign 0.00
R6372:Megf11 UTSW 9 64706625 missense probably damaging 1.00
R6811:Megf11 UTSW 9 64544641 missense probably damaging 0.99
R6868:Megf11 UTSW 9 64680309 missense probably damaging 1.00
R6980:Megf11 UTSW 9 64705850 missense probably damaging 1.00
R6984:Megf11 UTSW 9 64686452 missense probably benign
R7155:Megf11 UTSW 9 64647951 missense probably null 1.00
R7638:Megf11 UTSW 9 64679253 missense probably damaging 0.96
R7688:Megf11 UTSW 9 64691864 missense possibly damaging 0.92
R7840:Megf11 UTSW 9 64695427 missense possibly damaging 0.94
R8744:Megf11 UTSW 9 64544688 critical splice donor site probably null
R8799:Megf11 UTSW 9 64681391 missense probably benign 0.05
V5088:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
V5622:Megf11 UTSW 9 64690069 nonsense probably null
Z1088:Megf11 UTSW 9 64660476 missense probably damaging 1.00
Z1177:Megf11 UTSW 9 64680326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCTGGATTTGTCAGATG -3'
(R):5'- AGTTACCCCAGTCCCGTTTG -3'

Sequencing Primer
(F):5'- CCTCCTGGATTTGTCAGATGTATAC -3'
(R):5'- CTTTCAATCCAGGTGAAGGAAC -3'
Posted On2019-10-24