Incidental Mutation 'R7643:Itga7'
ID590364
Institutional Source Beutler Lab
Gene Symbol Itga7
Ensembl Gene ENSMUSG00000025348
Gene Nameintegrin alpha 7
Synonyms[a]7, alpha7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128933818-128958282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128953501 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 971 (D971G)
Ref Sequence ENSEMBL: ENSMUSP00000151960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026398] [ENSMUST00000099112] [ENSMUST00000218290]
Predicted Effect probably benign
Transcript: ENSMUST00000026398
SMART Domains Protein: ENSMUSP00000026398
Gene: ENSMUSG00000025347

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ubie_methyltran 40 193 2.8e-9 PFAM
Pfam:Methyltransf_23 43 222 5.5e-20 PFAM
Pfam:Methyltransf_31 68 225 1.6e-15 PFAM
Pfam:Methyltransf_18 71 175 4.6e-10 PFAM
Pfam:Methyltransf_25 74 168 2.3e-10 PFAM
Pfam:Methyltransf_12 75 170 8.8e-16 PFAM
Pfam:Methyltransf_11 75 172 1.9e-22 PFAM
Pfam:Methyltransf_8 120 192 3.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099112
AA Change: D967G

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: D967G

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218290
AA Change: D971G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219897
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Itga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Itga7 APN 10 128941854 missense possibly damaging 0.67
IGL00809:Itga7 APN 10 128939169 critical splice donor site probably null
IGL01448:Itga7 APN 10 128949468 nonsense probably null
IGL01675:Itga7 APN 10 128946855 missense probably damaging 1.00
IGL02158:Itga7 APN 10 128953782 missense possibly damaging 0.95
IGL02475:Itga7 APN 10 128934089 missense probably damaging 1.00
IGL02689:Itga7 APN 10 128946818 missense possibly damaging 0.83
IGL02946:Itga7 APN 10 128934083 missense probably benign
IGL03223:Itga7 APN 10 128948811 unclassified probably benign
R0662:Itga7 UTSW 10 128953531 missense probably damaging 1.00
R0972:Itga7 UTSW 10 128942877 missense probably damaging 0.98
R1449:Itga7 UTSW 10 128953501 missense probably benign 0.13
R1521:Itga7 UTSW 10 128957811 missense possibly damaging 0.63
R1597:Itga7 UTSW 10 128946863 missense probably benign 0.17
R1651:Itga7 UTSW 10 128948824 missense probably benign 0.01
R4718:Itga7 UTSW 10 128940734 frame shift probably null
R5011:Itga7 UTSW 10 128949447 missense possibly damaging 0.51
R5151:Itga7 UTSW 10 128944511 missense possibly damaging 0.91
R5287:Itga7 UTSW 10 128943158 missense probably benign 0.38
R5419:Itga7 UTSW 10 128944033 missense probably null 0.06
R5907:Itga7 UTSW 10 128942981 missense probably damaging 1.00
R6165:Itga7 UTSW 10 128942935 missense probably benign 0.16
R6189:Itga7 UTSW 10 128950403 missense possibly damaging 0.76
R6263:Itga7 UTSW 10 128944086 missense probably benign
R6612:Itga7 UTSW 10 128948993 missense possibly damaging 0.65
R6746:Itga7 UTSW 10 128949472 missense probably benign 0.13
R6850:Itga7 UTSW 10 128945516 missense probably damaging 1.00
R7226:Itga7 UTSW 10 128940932 missense probably damaging 0.98
R7257:Itga7 UTSW 10 128944413 missense possibly damaging 0.55
R7344:Itga7 UTSW 10 128940929 missense possibly damaging 0.63
R7456:Itga7 UTSW 10 128941936 missense probably damaging 1.00
R7545:Itga7 UTSW 10 128933906 start gained probably benign
R7644:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7822:Itga7 UTSW 10 128942966 missense probably benign 0.00
R7998:Itga7 UTSW 10 128934151 missense probably damaging 1.00
X0020:Itga7 UTSW 10 128942877 missense probably damaging 0.98
Z1088:Itga7 UTSW 10 128949163 missense probably benign 0.10
Z1176:Itga7 UTSW 10 128953827 missense probably benign 0.12
Z1177:Itga7 UTSW 10 128943214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTAGAGTTGAGGTAGGCAC -3'
(R):5'- CCCAGCCTGAGATTACAGAC -3'

Sequencing Primer
(F):5'- GCACTATTTAGGGCCAGAGG -3'
(R):5'- CCTGAGATTACAGACAAAATGGTGCC -3'
Posted On2019-10-24