Incidental Mutation 'R7643:Ankrd13b'
ID 590366
Institutional Source Beutler Lab
Gene Symbol Ankrd13b
Ensembl Gene ENSMUSG00000037907
Gene Name ankyrin repeat domain 13b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock # R7643 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77470485-77489678 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77473085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 395 (V395A)
Ref Sequence ENSEMBL: ENSMUSP00000073584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021190] [ENSMUST00000037593] [ENSMUST00000052515] [ENSMUST00000079770] [ENSMUST00000092892] [ENSMUST00000102493] [ENSMUST00000108391] [ENSMUST00000145934]
AlphaFold Q5F259
Predicted Effect probably benign
Transcript: ENSMUST00000021190
SMART Domains Protein: ENSMUSP00000021190
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037593
AA Change: V395A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907
AA Change: V395A

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052515
SMART Domains Protein: ENSMUSP00000056862
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079770
SMART Domains Protein: ENSMUSP00000078703
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 217 351 1.19e-91 SMART
low complexity region 374 389 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092892
AA Change: V395A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907
AA Change: V395A

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102493
SMART Domains Protein: ENSMUSP00000099551
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108391
SMART Domains Protein: ENSMUSP00000104028
Gene: ENSMUSG00000020836

DomainStartEndE-ValueType
DUF1899 4 68 7.45e-34 SMART
WD40 67 110 2.1e-7 SMART
WD40 120 160 2.07e-6 SMART
WD40 163 203 2.73e-6 SMART
DUF1900 257 391 1.19e-91 SMART
low complexity region 414 429 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907
AA Change: S153P

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145934
AA Change: V180A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907
AA Change: V180A

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Ankrd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ankrd13b APN 11 77472752 missense probably damaging 1.00
IGL01396:Ankrd13b APN 11 77472372 splice site probably null
IGL02731:Ankrd13b APN 11 77476219 missense probably damaging 0.99
R0310:Ankrd13b UTSW 11 77472745 missense possibly damaging 0.71
R0496:Ankrd13b UTSW 11 77473041 missense probably damaging 1.00
R0511:Ankrd13b UTSW 11 77473288 missense possibly damaging 0.89
R0831:Ankrd13b UTSW 11 77472759 missense probably damaging 0.99
R1156:Ankrd13b UTSW 11 77472861 missense probably damaging 1.00
R1237:Ankrd13b UTSW 11 77474574 missense probably damaging 1.00
R2259:Ankrd13b UTSW 11 77476342 missense probably damaging 1.00
R3110:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R3112:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R4190:Ankrd13b UTSW 11 77476375 missense probably damaging 1.00
R4471:Ankrd13b UTSW 11 77476214 missense probably damaging 1.00
R4599:Ankrd13b UTSW 11 77471668 missense probably benign
R5253:Ankrd13b UTSW 11 77473235 intron probably benign
R5677:Ankrd13b UTSW 11 77477544 missense probably damaging 0.99
R7073:Ankrd13b UTSW 11 77472509 missense probably benign 0.39
R7388:Ankrd13b UTSW 11 77472757 missense probably benign 0.02
R7417:Ankrd13b UTSW 11 77476194 missense probably damaging 0.97
R7592:Ankrd13b UTSW 11 77476501 missense probably benign 0.45
R7596:Ankrd13b UTSW 11 77472314 missense probably benign 0.18
R8434:Ankrd13b UTSW 11 77477726 missense probably benign 0.01
R8959:Ankrd13b UTSW 11 77476626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTAGGCACTGTCATCTAGCCCC -3'
(R):5'- ATGGAGCTGACCACCAAGAC -3'

Sequencing Primer
(F):5'- CTCCCTCATATCTAGGCCCCAGAG -3'
(R):5'- TGACCACCAAGACGCAGAAGTG -3'
Posted On 2019-10-24