Incidental Mutation 'R7643:Acaca'
ID590367
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84338356 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1670 (Y1670H)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: Y1670H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: Y1670H

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: Y1670H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: Y1670H

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Meta Mutation Damage Score 0.5406 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGCTTTCCAAGAAGCTTG -3'
(R):5'- ATCTTCAGGATCTACCCAGGC -3'

Sequencing Primer
(F):5'- AGAAGCTTGCTTCTTTCACAGTG -3'
(R):5'- GAACATATGGCGTATTTCTTCTGC -3'
Posted On2019-10-24