Incidental Mutation 'R7643:Krtap29-1'
ID 590368
Institutional Source Beutler Lab
Gene Symbol Krtap29-1
Ensembl Gene ENSMUSG00000078254
Gene Name keratin associated protein 29-1
Synonyms Gm14195
MMRRC Submission 045700-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7643 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 99868851-99869879 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99869024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 286 (G286S)
Ref Sequence ENSEMBL: ENSMUSP00000100672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105051]
AlphaFold A2A5X4
Predicted Effect probably damaging
Transcript: ENSMUST00000105051
AA Change: G286S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100672
Gene: ENSMUSG00000078254
AA Change: G286S

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
Pfam:Keratin_B2_2 105 149 2.9e-5 PFAM
Pfam:Keratin_B2_2 150 209 7.3e-6 PFAM
low complexity region 312 330 N/A INTRINSIC
Meta Mutation Damage Score 0.1939 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A G 9: 15,209,156 (GRCm39) F46S probably damaging Het
Acaca T C 11: 84,229,182 (GRCm39) Y1670H probably damaging Het
Acrbp G A 6: 125,030,795 (GRCm39) R272Q possibly damaging Het
Adcy6 T A 15: 98,491,449 (GRCm39) Q1050L probably benign Het
Amn1 C T 6: 149,086,529 (GRCm39) M44I probably benign Het
Ankrd13b A G 11: 77,363,911 (GRCm39) V395A probably benign Het
Ap3b2 T C 7: 81,126,820 (GRCm39) K310R probably benign Het
Bnc2 T C 4: 84,424,811 (GRCm39) D123G probably benign Het
Bst1 G A 5: 43,997,791 (GRCm39) M263I probably benign Het
Ccdc7a C T 8: 129,616,292 (GRCm39) G937E probably damaging Het
Cep290 A G 10: 100,373,415 (GRCm39) M1232V probably benign Het
Cfhr1 A G 1: 139,481,323 (GRCm39) Y186H possibly damaging Het
Dnah7c A T 1: 46,641,973 (GRCm39) H1203L probably benign Het
Emc7 A G 2: 112,285,624 (GRCm39) E71G probably benign Het
Exoc3l4 G A 12: 111,388,369 (GRCm39) probably benign Het
Fam83c A G 2: 155,672,924 (GRCm39) F278L possibly damaging Het
Gabpb2 C A 3: 95,107,536 (GRCm39) V180L probably benign Het
Gbp2b G T 3: 142,309,370 (GRCm39) Q160H probably benign Het
Gm19965 C G 1: 116,749,959 (GRCm39) Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gon4l T A 3: 88,810,114 (GRCm39) D1774E probably damaging Het
Gpr15 A C 16: 58,538,179 (GRCm39) Y303* probably null Het
Greb1 T C 12: 16,761,997 (GRCm39) D461G probably damaging Het
Gria4 T C 9: 4,793,950 (GRCm39) N36S probably benign Het
Hacd1 T C 2: 14,049,602 (GRCm39) I119V probably damaging Het
Ing5 T A 1: 93,740,155 (GRCm39) D101E probably damaging Het
Irak4 T A 15: 94,456,709 (GRCm39) N297K probably benign Het
Itga7 A G 10: 128,789,370 (GRCm39) D971G probably benign Het
Klf5 A G 14: 99,550,614 (GRCm39) E397G possibly damaging Het
Lrp2bp A T 8: 46,473,564 (GRCm39) probably null Het
Marchf4 T G 1: 72,486,379 (GRCm39) Q266H probably damaging Het
Med23 A G 10: 24,781,863 (GRCm39) T1056A probably benign Het
Megf11 T C 9: 64,613,914 (GRCm39) L1079P probably damaging Het
Mycbp2 G T 14: 103,583,701 (GRCm39) L85I probably benign Het
Nlgn2 G T 11: 69,718,711 (GRCm39) Q290K probably damaging Het
Nox4 A T 7: 86,972,962 (GRCm39) E323V probably damaging Het
Nup93 T C 8: 95,013,247 (GRCm39) probably null Het
Or10d5b T A 9: 39,886,117 (GRCm39) M1L unknown Het
Or14a257 C T 7: 86,138,776 (GRCm39) probably null Het
Or51e1 C T 7: 102,358,745 (GRCm39) T93I probably benign Het
Otop3 T C 11: 115,230,474 (GRCm39) L117P probably damaging Het
Pde6c C A 19: 38,129,869 (GRCm39) Q260K probably damaging Het
Plb1 C T 5: 32,404,901 (GRCm39) Q20* probably null Het
Qser1 A T 2: 104,617,322 (GRCm39) Y1163* probably null Het
Rbm12 A T 2: 155,940,137 (GRCm39) I45N unknown Het
Rictor T A 15: 6,798,750 (GRCm39) Y332* probably null Het
Rpp14 C A 14: 8,090,325 (GRCm38) S83* probably null Het
Sel1l3 C T 5: 53,280,504 (GRCm39) probably null Het
Setd2 T C 9: 110,396,908 (GRCm39) probably null Het
Spink5 A G 18: 44,143,319 (GRCm39) T759A probably benign Het
Spon2 T A 5: 33,374,800 (GRCm39) E2V probably benign Het
Tdrd1 T C 19: 56,826,140 (GRCm39) S144P probably damaging Het
Tex15 A C 8: 34,065,148 (GRCm39) Y1526S probably damaging Het
Tex55 A G 16: 38,648,225 (GRCm39) Y295H probably benign Het
Tnfrsf21 T C 17: 43,348,807 (GRCm39) S140P probably benign Het
Trav6-2 T A 14: 52,904,899 (GRCm39) M11K probably benign Het
Trp53bp1 G T 2: 121,078,295 (GRCm39) probably null Het
Ttn T C 2: 76,565,171 (GRCm39) N28352S possibly damaging Het
Uckl1 T C 2: 181,214,899 (GRCm39) I292V probably benign Het
Unc13b T A 4: 43,216,333 (GRCm39) S211T probably benign Het
Zcchc4 T C 5: 52,965,635 (GRCm39) I313T possibly damaging Het
Zfp106 C T 2: 120,343,215 (GRCm39) R1811K probably benign Het
Zfp599 G T 9: 22,161,188 (GRCm39) Q326K probably benign Het
Zscan4e A T 7: 11,043,452 (GRCm39) M108K probably damaging Het
Other mutations in Krtap29-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Krtap29-1 APN 11 99,869,105 (GRCm39) missense possibly damaging 0.93
IGL02218:Krtap29-1 APN 11 99,869,884 (GRCm39) splice site probably null
IGL02306:Krtap29-1 APN 11 99,869,092 (GRCm39) missense probably damaging 0.98
IGL02325:Krtap29-1 APN 11 99,869,159 (GRCm39) missense probably damaging 1.00
IGL02750:Krtap29-1 APN 11 99,869,510 (GRCm39) missense probably benign 0.00
IGL03061:Krtap29-1 APN 11 99,869,455 (GRCm39) missense possibly damaging 0.77
IGL03303:Krtap29-1 APN 11 99,869,669 (GRCm39) missense probably benign 0.03
R2069:Krtap29-1 UTSW 11 99,869,438 (GRCm39) missense probably damaging 0.99
R6274:Krtap29-1 UTSW 11 99,869,809 (GRCm39) missense probably null 0.00
R8786:Krtap29-1 UTSW 11 99,869,465 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGTTGTCAAGAAGTGGGTCC -3'
(R):5'- CTTAAGTCCTGCCAGTCAACTC -3'

Sequencing Primer
(F):5'- AAGTGGGTCCATAGGTGCC -3'
(R):5'- CTGCCAGCCATTAACTTGTATGTG -3'
Posted On 2019-10-24