Incidental Mutation 'R7643:Klf5'
ID590374
Institutional Source Beutler Lab
Gene Symbol Klf5
Ensembl Gene ENSMUSG00000005148
Gene NameKruppel-like factor 5
SynonymsIKLF, Bteb2, 4930520J07Rik, CKLF
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location99298691-99315036 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99313178 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 397 (E397G)
Ref Sequence ENSEMBL: ENSMUSP00000005279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005279
AA Change: E397G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005279
Gene: ENSMUSG00000005148
AA Change: E397G

DomainStartEndE-ValueType
low complexity region 53 65 N/A INTRINSIC
low complexity region 166 173 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
ZnF_C2H2 362 386 3.83e-2 SMART
ZnF_C2H2 392 416 2.47e-5 SMART
ZnF_C2H2 422 444 1.2e-3 SMART
Meta Mutation Damage Score 0.1923 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. The encoded protein is a transcriptional activator that binds directly to a specific recognition motif in the promoters of target genes. This protein acts downstream of multiple different signaling pathways and is regulated by post-translational modification. It may participate in both promoting and suppressing cell proliferation. Expression of this gene may be changed in a variety of different cancers and in cardiovascular disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice die during gestation, while heterozygotes exhibit abnormal cardiovascular remodeling after external stress. Mice homozygous for a floxed allele activated in the prostate exhibit increased cell proliferation and hyperplasia in the prostate without neoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Klf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Klf5 APN 14 99301721 missense probably benign 0.01
IGL02380:Klf5 APN 14 99301458 missense possibly damaging 0.67
Bernie UTSW 14 99302230 missense probably damaging 1.00
I0000:Klf5 UTSW 14 99303475 missense probably damaging 1.00
R0133:Klf5 UTSW 14 99301882 missense probably benign
R1672:Klf5 UTSW 14 99301550 missense probably damaging 0.98
R1914:Klf5 UTSW 14 99301921 missense probably benign 0.01
R2193:Klf5 UTSW 14 99298970 unclassified probably benign
R3892:Klf5 UTSW 14 99299073 missense probably benign 0.00
R4446:Klf5 UTSW 14 99302230 missense probably damaging 1.00
R5437:Klf5 UTSW 14 99301459 nonsense probably null
R5707:Klf5 UTSW 14 99301508 missense probably benign
R6475:Klf5 UTSW 14 99301381 missense probably benign 0.00
R6552:Klf5 UTSW 14 99301642 missense probably benign
R6982:Klf5 UTSW 14 99313235 missense probably damaging 1.00
R7250:Klf5 UTSW 14 99299019 missense probably benign 0.00
R7938:Klf5 UTSW 14 99299008 missense probably damaging 0.98
R8272:Klf5 UTSW 14 99302104 missense possibly damaging 0.67
R8396:Klf5 UTSW 14 99302234 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCATGTACATTATCCTCGCCG -3'
(R):5'- TGCGGTTTAAAGGATGGCAG -3'

Sequencing Primer
(F):5'- GCTACTTGTATATCATCCTCGCCG -3'
(R):5'- GGACTGCAAGGCGTCAG -3'
Posted On2019-10-24