Incidental Mutation 'R7643:Adcy6'
ID590378
Institutional Source Beutler Lab
Gene Symbol Adcy6
Ensembl Gene ENSMUSG00000022994
Gene Nameadenylate cyclase 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98589973-98610076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98593568 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1050 (Q1050L)
Ref Sequence ENSEMBL: ENSMUSP00000093939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023728] [ENSMUST00000096224] [ENSMUST00000228566] [ENSMUST00000228903]
Predicted Effect probably benign
Transcript: ENSMUST00000023728
Predicted Effect probably benign
Transcript: ENSMUST00000096224
AA Change: Q1050L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: Q1050L

DomainStartEndE-ValueType
low complexity region 150 166 N/A INTRINSIC
low complexity region 169 177 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
CYCc 331 532 2.95e-63 SMART
Pfam:DUF1053 580 669 3.5e-18 PFAM
transmembrane domain 701 723 N/A INTRINSIC
transmembrane domain 744 763 N/A INTRINSIC
transmembrane domain 815 834 N/A INTRINSIC
transmembrane domain 839 861 N/A INTRINSIC
Blast:CYCc 885 929 5e-20 BLAST
CYCc 939 1147 4.81e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228566
AA Change: Q1048L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228903
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Adcy6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Adcy6 APN 15 98598976 missense probably damaging 1.00
IGL01132:Adcy6 APN 15 98597851 missense probably benign 0.14
IGL01642:Adcy6 APN 15 98594509 missense possibly damaging 0.88
IGL01647:Adcy6 APN 15 98600275 missense probably damaging 1.00
IGL01788:Adcy6 APN 15 98596519 nonsense probably null
IGL02122:Adcy6 APN 15 98598882 missense possibly damaging 0.66
IGL02210:Adcy6 APN 15 98594971 missense possibly damaging 0.63
IGL02249:Adcy6 APN 15 98599914 missense probably damaging 1.00
IGL02404:Adcy6 APN 15 98596938 missense probably benign
IGL02691:Adcy6 APN 15 98604304 missense probably damaging 1.00
PIT4515001:Adcy6 UTSW 15 98595146 missense probably benign 0.04
R0178:Adcy6 UTSW 15 98604215 missense probably benign 0.00
R0497:Adcy6 UTSW 15 98597725 critical splice donor site probably null
R0739:Adcy6 UTSW 15 98598379 missense probably benign 0.00
R1454:Adcy6 UTSW 15 98604728 missense probably damaging 1.00
R1473:Adcy6 UTSW 15 98592743 missense probably damaging 0.99
R1536:Adcy6 UTSW 15 98600007 missense probably damaging 1.00
R1927:Adcy6 UTSW 15 98598498 splice site probably null
R2178:Adcy6 UTSW 15 98594355 missense probably damaging 1.00
R2294:Adcy6 UTSW 15 98597441 missense possibly damaging 0.48
R2356:Adcy6 UTSW 15 98597016 splice site probably null
R2898:Adcy6 UTSW 15 98593488 missense probably damaging 1.00
R3001:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3002:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3794:Adcy6 UTSW 15 98598943 missense probably damaging 1.00
R3884:Adcy6 UTSW 15 98597174 missense probably benign 0.06
R4348:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4351:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4542:Adcy6 UTSW 15 98598988 missense possibly damaging 0.70
R4548:Adcy6 UTSW 15 98598659 missense probably damaging 1.00
R5693:Adcy6 UTSW 15 98603989 missense probably damaging 1.00
R5707:Adcy6 UTSW 15 98598741 missense probably damaging 1.00
R5994:Adcy6 UTSW 15 98593664 missense probably damaging 1.00
R5998:Adcy6 UTSW 15 98594354 nonsense probably null
R6142:Adcy6 UTSW 15 98598422 missense probably benign
R6242:Adcy6 UTSW 15 98604015 nonsense probably null
R6305:Adcy6 UTSW 15 98598645 missense probably benign 0.13
R6751:Adcy6 UTSW 15 98596205 missense probably benign
R7130:Adcy6 UTSW 15 98597229 missense probably benign
R7335:Adcy6 UTSW 15 98603876 missense probably benign 0.29
R7658:Adcy6 UTSW 15 98596067 missense probably benign 0.00
R7748:Adcy6 UTSW 15 98604556 missense probably benign 0.01
R7761:Adcy6 UTSW 15 98600014 missense probably damaging 1.00
R7774:Adcy6 UTSW 15 98596533 missense probably benign
X0020:Adcy6 UTSW 15 98598735 missense probably damaging 0.99
X0021:Adcy6 UTSW 15 98603942 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTCCTGACGGAGAACAACC -3'
(R):5'- CACCCACTAAAGCAATGGGG -3'

Sequencing Primer
(F):5'- TGACGGAGAACAACCCACCC -3'
(R):5'- CACTAAAGCAATGGGGCTCTCG -3'
Posted On2019-10-24