Incidental Mutation 'R7643:4930435E12Rik'
ID 590379
Institutional Source Beutler Lab
Gene Symbol 4930435E12Rik
Ensembl Gene ENSMUSG00000022798
Gene Name RIKEN cDNA 4930435E12 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R7643 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 38812206-38828749 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38827863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 295 (Y295H)
Ref Sequence ENSEMBL: ENSMUSP00000113120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122078]
AlphaFold A6X8Z9
Predicted Effect probably benign
Transcript: ENSMUST00000122078
AA Change: Y295H

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113120
Gene: ENSMUSG00000022798
AA Change: Y295H

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
low complexity region 307 317 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in 4930435E12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:4930435E12Rik APN 16 38827893 missense possibly damaging 0.61
IGL01998:4930435E12Rik APN 16 38828224 missense probably benign 0.00
IGL02454:4930435E12Rik APN 16 38827947 missense probably benign 0.02
IGL03216:4930435E12Rik APN 16 38828690 missense possibly damaging 0.59
IGL03325:4930435E12Rik APN 16 38827993 missense probably damaging 1.00
IGL03397:4930435E12Rik APN 16 38828693 missense probably damaging 1.00
R7924_4930435E12Rik_239 UTSW 16 38812464 nonsense probably null
BB001:4930435E12Rik UTSW 16 38812464 nonsense probably null
BB011:4930435E12Rik UTSW 16 38812464 nonsense probably null
R0242:4930435E12Rik UTSW 16 38824567 splice site probably benign
R0446:4930435E12Rik UTSW 16 38828702 missense probably benign 0.01
R0607:4930435E12Rik UTSW 16 38828364 missense probably benign 0.02
R1918:4930435E12Rik UTSW 16 38828088 missense possibly damaging 0.56
R1953:4930435E12Rik UTSW 16 38827913 missense possibly damaging 0.78
R3417:4930435E12Rik UTSW 16 38828740 missense probably benign 0.17
R4601:4930435E12Rik UTSW 16 38828018 missense probably benign 0.14
R4860:4930435E12Rik UTSW 16 38828145 missense probably damaging 0.97
R4860:4930435E12Rik UTSW 16 38828145 missense probably damaging 0.97
R5551:4930435E12Rik UTSW 16 38827974 missense probably benign 0.28
R7568:4930435E12Rik UTSW 16 38828447 missense possibly damaging 0.95
R7623:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7669:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7670:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7671:4930435E12Rik UTSW 16 38828091 missense possibly damaging 0.87
R7924:4930435E12Rik UTSW 16 38812464 nonsense probably null
R9385:4930435E12Rik UTSW 16 38828045 missense probably benign 0.11
RF013:4930435E12Rik UTSW 16 38828001 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GGAGGCAACACATCTCTTTTG -3'
(R):5'- CTGGCCAAAGATTACAGCCTTG -3'

Sequencing Primer
(F):5'- GTGTTACATCCTTCCTGAGACC -3'
(R):5'- ACAGCCTTGCACATTTGAAG -3'
Posted On 2019-10-24