Incidental Mutation 'R7643:Pde6c'
ID590383
Institutional Source Beutler Lab
Gene Symbol Pde6c
Ensembl Gene ENSMUSG00000024992
Gene Namephosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonymscpfl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location38132781-38183958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38141421 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 260 (Q260K)
Ref Sequence ENSEMBL: ENSMUSP00000025956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025956] [ENSMUST00000112329]
Predicted Effect probably damaging
Transcript: ENSMUST00000025956
AA Change: Q260K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025956
Gene: ENSMUSG00000024992
AA Change: Q260K

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 7.57e-9 SMART
low complexity region 827 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112329
AA Change: Q260K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107948
Gene: ENSMUSG00000024992
AA Change: Q260K

DomainStartEndE-ValueType
GAF 75 234 6.27e-26 SMART
GAF 256 443 1.48e-22 SMART
Blast:HDc 490 543 1e-8 BLAST
HDc 559 737 1.62e-8 SMART
low complexity region 802 811 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-prime subunit of cone phosphodiesterase, which is composed of a homodimer of two alpha-prime subunits and 3 smaller proteins of 11, 13, and 15 kDa. Mutations in this gene are associated with cone dystrophy type 4 (COD4). [provided by RefSeq, Mar 2010]
PHENOTYPE: A spontaneous mutation in this gene results in abnormal cone photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Cfhr1 A G 1: 139,553,585 Y186H possibly damaging Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Pde6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Pde6c APN 19 38162876 splice site probably benign
IGL01333:Pde6c APN 19 38175695 missense probably benign 0.05
IGL01390:Pde6c APN 19 38161928 missense probably benign 0.01
IGL02508:Pde6c APN 19 38157500 missense probably benign 0.13
IGL02542:Pde6c APN 19 38178130 missense probably damaging 1.00
IGL02546:Pde6c APN 19 38140040 missense probably benign 0.00
IGL02661:Pde6c APN 19 38180800 missense probably damaging 0.97
silverton UTSW 19 38162845 missense probably damaging 1.00
IGL03097:Pde6c UTSW 19 38178271 missense probably damaging 1.00
R0117:Pde6c UTSW 19 38151531 missense probably damaging 1.00
R0128:Pde6c UTSW 19 38169365 splice site probably benign
R0349:Pde6c UTSW 19 38162349 missense probably damaging 1.00
R0612:Pde6c UTSW 19 38133246 missense probably benign 0.03
R0692:Pde6c UTSW 19 38180250 missense probably damaging 0.99
R0785:Pde6c UTSW 19 38133180 missense probably benign
R1605:Pde6c UTSW 19 38141492 missense probably damaging 1.00
R1643:Pde6c UTSW 19 38161958 missense possibly damaging 0.56
R1694:Pde6c UTSW 19 38180225 missense probably damaging 1.00
R1781:Pde6c UTSW 19 38151698 missense possibly damaging 0.69
R1900:Pde6c UTSW 19 38161940 missense probably damaging 1.00
R1944:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R1945:Pde6c UTSW 19 38157519 missense probably damaging 1.00
R2143:Pde6c UTSW 19 38162329 missense probably damaging 1.00
R2497:Pde6c UTSW 19 38153694 missense probably damaging 1.00
R3737:Pde6c UTSW 19 38140224 missense probably damaging 1.00
R4010:Pde6c UTSW 19 38169436 missense probably damaging 1.00
R4241:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4242:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4259:Pde6c UTSW 19 38162845 missense probably damaging 1.00
R4661:Pde6c UTSW 19 38169439 missense probably damaging 1.00
R4677:Pde6c UTSW 19 38157385 missense probably damaging 1.00
R4708:Pde6c UTSW 19 38180893 missense possibly damaging 0.92
R4889:Pde6c UTSW 19 38133151 missense probably benign 0.23
R4898:Pde6c UTSW 19 38150624 missense possibly damaging 0.81
R4941:Pde6c UTSW 19 38151565 missense probably damaging 1.00
R5448:Pde6c UTSW 19 38133175 missense probably damaging 1.00
R6174:Pde6c UTSW 19 38140229 missense possibly damaging 0.57
R6249:Pde6c UTSW 19 38158560 critical splice donor site probably null
R6270:Pde6c UTSW 19 38158436 missense probably damaging 1.00
R7183:Pde6c UTSW 19 38133090 missense probably benign 0.00
R7428:Pde6c UTSW 19 38157536 critical splice donor site probably null
R7429:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7430:Pde6c UTSW 19 38141439 missense probably damaging 1.00
R7793:Pde6c UTSW 19 38159753 missense possibly damaging 0.94
R7811:Pde6c UTSW 19 38140059 missense possibly damaging 0.91
R8097:Pde6c UTSW 19 38161966 nonsense probably null
Z1176:Pde6c UTSW 19 38132881 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCACCCTGCTTAGAGAACCC -3'
(R):5'- AGCCTTCACAGAGCTGGTTC -3'

Sequencing Primer
(F):5'- CCTGCTTAGAGAACCCATGATGTTTG -3'
(R):5'- ACAGAGCTGGTTCATGCTATC -3'
Posted On2019-10-24