Incidental Mutation 'R7644:Ptprc'
ID 590391
Institutional Source Beutler Lab
Gene Symbol Ptprc
Ensembl Gene ENSMUSG00000026395
Gene Name protein tyrosine phosphatase receptor type C
Synonyms Ly-5, T200, CD45, B220, Lyt-4
MMRRC Submission 045723-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7644 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 137990599-138103446 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 137995645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1012 (A1012V)
Ref Sequence ENSEMBL: ENSMUSP00000138800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301]
AlphaFold P06800
Predicted Effect probably benign
Transcript: ENSMUST00000182283
AA Change: A1012V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: A1012V

DomainStartEndE-ValueType
Pfam:PTP_N 7 32 4.2e-13 PFAM
low complexity region 33 66 N/A INTRINSIC
Pfam:CD45 72 131 2.3e-24 PFAM
FN3 235 319 2.28e0 SMART
FN3 335 413 3.48e-1 SMART
transmembrane domain 428 449 N/A INTRINSIC
PTPc 502 764 7.57e-127 SMART
PTPc 793 1079 1.39e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182755
AA Change: A988V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: A988V

DomainStartEndE-ValueType
Pfam:PTP_N 7 34 5.5e-13 PFAM
Pfam:CD45 48 107 2.3e-24 PFAM
FN3 211 295 2.28e0 SMART
FN3 311 389 3.48e-1 SMART
transmembrane domain 404 425 N/A INTRINSIC
PTPc 478 740 7.57e-127 SMART
PTPc 769 1055 1.39e-102 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: A1151V

DomainStartEndE-ValueType
Pfam:PTP_N 7 33 2.7e-13 PFAM
low complexity region 111 128 N/A INTRINSIC
low complexity region 170 205 N/A INTRINSIC
Pfam:CD45 211 270 2.1e-24 PFAM
FN3 374 458 2.28e0 SMART
FN3 474 552 3.48e-1 SMART
transmembrane domain 567 588 N/A INTRINSIC
PTPc 641 903 7.57e-127 SMART
PTPc 932 1218 1.39e-102 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,687,966 (GRCm39) R209Q possibly damaging Het
Abl2 A G 1: 156,443,563 (GRCm39) D24G probably benign Het
Adar C T 3: 89,652,826 (GRCm39) A754V probably benign Het
Adcy8 C T 15: 64,571,218 (GRCm39) V1172I possibly damaging Het
Adgrl2 C T 3: 148,544,789 (GRCm39) V769M probably damaging Het
Akna T A 4: 63,313,634 (GRCm39) Q163L possibly damaging Het
Alox15 C T 11: 70,236,368 (GRCm39) A511T probably null Het
Ano8 C T 8: 71,937,474 (GRCm39) G90D probably damaging Het
Aqp5 G A 15: 99,492,107 (GRCm39) R235H probably damaging Het
B3galt4 A T 17: 34,169,419 (GRCm39) V273E probably damaging Het
Ccdc125 C T 13: 100,814,884 (GRCm39) probably null Het
Ccdc90b A G 7: 92,216,868 (GRCm39) R47G possibly damaging Het
Celsr2 G T 3: 108,320,806 (GRCm39) L669I probably damaging Het
Clasp1 T G 1: 118,440,480 (GRCm39) probably null Het
Clec4a2 C T 6: 123,101,974 (GRCm39) P43L probably benign Het
Cntn1 T C 15: 92,207,890 (GRCm39) I827T probably benign Het
Col9a1 G T 1: 24,224,243 (GRCm39) V142F unknown Het
Cplane1 T A 15: 8,252,611 (GRCm39) D1944E probably benign Het
Cts7 G T 13: 61,504,782 (GRCm39) Y23* probably null Het
Dcdc2a T A 13: 25,291,674 (GRCm39) Y220N probably damaging Het
Dennd2b A T 7: 109,156,000 (GRCm39) L250* probably null Het
Dmxl1 T G 18: 50,026,619 (GRCm39) V1909G probably benign Het
Ehd2 G A 7: 15,691,474 (GRCm39) P286L possibly damaging Het
Elf3 G T 1: 135,184,244 (GRCm39) A208E possibly damaging Het
Eml5 A G 12: 98,822,203 (GRCm39) I775T probably benign Het
Ephb1 T C 9: 101,813,393 (GRCm39) T791A probably damaging Het
Fanci C A 7: 79,094,219 (GRCm39) S1105* probably null Het
Fastkd1 T A 2: 69,527,184 (GRCm39) probably null Het
Fat4 A G 3: 39,064,390 (GRCm39) E4782G possibly damaging Het
Fnta T C 8: 26,503,516 (GRCm39) I90V probably damaging Het
Fosl1 C T 19: 5,500,332 (GRCm39) R84* probably null Het
Gdf2 T C 14: 33,666,847 (GRCm39) F190L probably benign Het
Gzmn T A 14: 56,404,776 (GRCm39) Q88L probably damaging Het
Hat1 T A 2: 71,240,525 (GRCm39) L73Q probably damaging Het
Hdhd2 G A 18: 77,031,871 (GRCm39) G109E possibly damaging Het
Il22ra1 A G 4: 135,460,346 (GRCm39) N34S probably damaging Het
Ino80d T C 1: 63,097,930 (GRCm39) T760A probably benign Het
Itga7 A G 10: 128,789,370 (GRCm39) D971G probably benign Het
Kdm6b T C 11: 69,291,032 (GRCm39) N1574S unknown Het
Kel T C 6: 41,667,742 (GRCm39) E400G probably benign Het
Kif22 G A 7: 126,632,134 (GRCm39) T350I probably damaging Het
Kif26b A G 1: 178,506,839 (GRCm39) N305S probably benign Het
Klk12 A C 7: 43,419,134 (GRCm39) Q33P probably damaging Het
Klk1b24 G A 7: 43,841,304 (GRCm39) probably null Het
Krtap31-1 T A 11: 99,799,048 (GRCm39) C84S possibly damaging Het
Ky T A 9: 102,414,972 (GRCm39) S295T probably benign Het
Lpin3 T A 2: 160,738,690 (GRCm39) M214K probably benign Het
Mak T A 13: 41,183,586 (GRCm39) N565Y probably benign Het
Mphosph6 T C 8: 118,528,623 (GRCm39) T7A probably benign Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Myh11 T C 16: 14,039,688 (GRCm39) T814A Het
Nmbr T C 10: 14,636,433 (GRCm39) L134P probably damaging Het
Nup107 C T 10: 117,606,375 (GRCm39) V456M probably damaging Het
Or56b1b A G 7: 108,164,649 (GRCm39) S118P possibly damaging Het
Or8g22 C A 9: 38,958,638 (GRCm39) D26Y probably damaging Het
Pink1 A T 4: 138,044,683 (GRCm39) H351Q probably damaging Het
Piwil4 A T 9: 14,645,711 (GRCm39) probably null Het
Pkd1l1 C A 11: 8,825,758 (GRCm39) V1498F Het
Polb A G 8: 23,130,443 (GRCm39) I161T probably benign Het
Polg A T 7: 79,101,416 (GRCm39) L1097Q probably damaging Het
Prelp T C 1: 133,842,356 (GRCm39) N263S probably benign Het
Pten T C 19: 32,789,234 (GRCm39) C211R probably damaging Het
Ptprr T A 10: 115,884,133 (GRCm39) H63Q probably benign Het
Rapsn A T 2: 90,872,299 (GRCm39) H211L possibly damaging Het
Reln T C 5: 22,183,929 (GRCm39) N1690S probably benign Het
Rpap2 A G 5: 107,768,167 (GRCm39) E335G probably benign Het
Rspry1 T A 8: 95,385,396 (GRCm39) S567T probably benign Het
Sf3b1 G A 1: 55,036,302 (GRCm39) R924* probably null Het
Sftpb G A 6: 72,286,818 (GRCm39) E241K probably benign Het
Smarca4 G T 9: 21,566,950 (GRCm39) A677S probably benign Het
Srrm2 G A 17: 24,038,294 (GRCm39) R1646Q unknown Het
Tex15 T A 8: 34,064,445 (GRCm39) C1292S probably benign Het
Tmem140 A G 6: 34,849,708 (GRCm39) I75V probably benign Het
Trhr2 T A 8: 123,084,061 (GRCm39) Q313L possibly damaging Het
Trim35 A G 14: 66,534,546 (GRCm39) T10A unknown Het
Ttn T C 2: 76,750,124 (GRCm39) I3642V probably benign Het
Ugt1a2 T C 1: 88,128,507 (GRCm39) L50P probably damaging Het
Unc13a C A 8: 72,087,182 (GRCm39) V1522L probably benign Het
Usp33 A G 3: 152,063,589 (GRCm39) D21G possibly damaging Het
Vmn1r90 G A 7: 14,295,616 (GRCm39) Q161* probably null Het
Vmn2r117 A T 17: 23,696,265 (GRCm39) W381R probably damaging Het
Vmn2r16 G C 5: 109,487,837 (GRCm39) A237P probably damaging Het
Vmn2r74 A G 7: 85,606,746 (GRCm39) V200A probably benign Het
Yjefn3 C T 8: 70,340,544 (GRCm39) V227M probably damaging Het
Zfp652 T C 11: 95,640,914 (GRCm39) F280L probably damaging Het
Zfp748 G A 13: 67,689,568 (GRCm39) T564I probably damaging Het
Other mutations in Ptprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
lochy APN 1 138,011,528 (GRCm39) splice site probably benign
IGL00486:Ptprc APN 1 138,043,359 (GRCm39) missense probably damaging 0.97
IGL00771:Ptprc APN 1 138,041,415 (GRCm39) missense probably benign 0.00
IGL00833:Ptprc APN 1 138,006,230 (GRCm39) missense possibly damaging 0.55
IGL00919:Ptprc APN 1 138,041,380 (GRCm39) missense probably damaging 1.00
IGL01020:Ptprc APN 1 138,047,911 (GRCm39) critical splice acceptor site probably null 0.00
IGL01024:Ptprc APN 1 138,008,650 (GRCm39) missense probably damaging 1.00
IGL01302:Ptprc APN 1 138,027,369 (GRCm39) missense possibly damaging 0.82
IGL01548:Ptprc APN 1 138,027,219 (GRCm39) critical splice donor site probably null 0.00
IGL01620:Ptprc APN 1 137,996,148 (GRCm39) missense possibly damaging 0.88
IGL01775:Ptprc APN 1 137,992,497 (GRCm39) missense probably damaging 1.00
IGL01820:Ptprc APN 1 137,993,936 (GRCm39) missense probably damaging 1.00
IGL02340:Ptprc APN 1 137,998,957 (GRCm39) missense probably damaging 1.00
IGL02943:Ptprc APN 1 138,027,251 (GRCm39) missense probably damaging 0.99
IGL03169:Ptprc APN 1 138,041,357 (GRCm39) missense probably benign 0.15
IGL03308:Ptprc APN 1 138,054,058 (GRCm39) missense possibly damaging 0.70
IGL03404:Ptprc APN 1 138,020,739 (GRCm39) missense probably damaging 1.00
belittle UTSW 1 138,137,493 (GRCm38) intron probably benign
Benighted UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
bletchley UTSW 1 138,045,600 (GRCm39) missense probably benign
Blush UTSW 1 138,045,458 (GRCm39) intron probably benign
bruise UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
chor_muang UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
crystal UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
Dumpling UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
fluorescent UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
fuchsia UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
Gentian UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
guotie UTSW 1 137,996,139 (GRCm39) nonsense probably null
guotie2 UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
Guotie3 UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
Gyoza UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
Half_measure UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
jirisan UTSW 1 138,041,416 (GRCm39) nonsense probably null
mauve UTSW 1 138,027,423 (GRCm39) missense probably benign
Perverse UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
petechiae UTSW 1 138,041,446 (GRCm39) nonsense probably null
ultra UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
violaceous UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R0013:Ptprc UTSW 1 138,041,297 (GRCm39) splice site probably null
R0189:Ptprc UTSW 1 138,010,453 (GRCm39) missense probably benign 0.10
R0390:Ptprc UTSW 1 138,050,313 (GRCm39) missense possibly damaging 0.71
R0504:Ptprc UTSW 1 138,016,435 (GRCm39) missense probably damaging 1.00
R0602:Ptprc UTSW 1 138,017,223 (GRCm39) splice site probably benign
R0627:Ptprc UTSW 1 137,996,058 (GRCm39) missense probably damaging 0.99
R0632:Ptprc UTSW 1 138,001,348 (GRCm39) missense probably benign 0.01
R0751:Ptprc UTSW 1 138,020,668 (GRCm39) missense probably damaging 1.00
R0839:Ptprc UTSW 1 138,028,870 (GRCm39) missense possibly damaging 0.47
R0942:Ptprc UTSW 1 137,996,139 (GRCm39) nonsense probably null
R0943:Ptprc UTSW 1 138,038,902 (GRCm39) missense probably damaging 0.96
R1159:Ptprc UTSW 1 138,000,057 (GRCm39) missense probably damaging 1.00
R1442:Ptprc UTSW 1 138,000,050 (GRCm39) missense probably damaging 1.00
R1489:Ptprc UTSW 1 138,047,824 (GRCm39) missense possibly damaging 0.91
R1728:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1728:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1728:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1728:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1728:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1729:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1729:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1729:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1729:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1730:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1730:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1730:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1730:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1730:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1739:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1739:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1739:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1739:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1739:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1762:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1762:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1762:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1762:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1762:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1783:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1783:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1783:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1783:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1784:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1784:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1784:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1784:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1785:Ptprc UTSW 1 138,027,414 (GRCm39) missense probably benign 0.05
R1785:Ptprc UTSW 1 138,035,561 (GRCm39) missense probably benign 0.22
R1785:Ptprc UTSW 1 138,039,992 (GRCm39) missense possibly damaging 0.53
R1785:Ptprc UTSW 1 138,035,575 (GRCm39) missense probably benign 0.09
R1785:Ptprc UTSW 1 138,035,562 (GRCm39) missense probably benign 0.04
R1862:Ptprc UTSW 1 138,039,965 (GRCm39) missense probably benign 0.13
R2145:Ptprc UTSW 1 138,001,419 (GRCm39) missense probably damaging 1.00
R2290:Ptprc UTSW 1 138,038,926 (GRCm39) missense probably benign 0.00
R2403:Ptprc UTSW 1 138,016,270 (GRCm39) missense probably damaging 1.00
R2439:Ptprc UTSW 1 137,993,890 (GRCm39) missense possibly damaging 0.67
R2887:Ptprc UTSW 1 138,007,916 (GRCm39) missense probably damaging 1.00
R2906:Ptprc UTSW 1 137,992,272 (GRCm39) missense possibly damaging 0.93
R3774:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3775:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3776:Ptprc UTSW 1 137,992,511 (GRCm39) missense probably damaging 0.97
R3834:Ptprc UTSW 1 138,011,305 (GRCm39) missense probably damaging 1.00
R4019:Ptprc UTSW 1 138,006,254 (GRCm39) missense probably damaging 1.00
R4377:Ptprc UTSW 1 137,995,663 (GRCm39) missense probably benign 0.04
R4580:Ptprc UTSW 1 137,998,989 (GRCm39) missense probably benign 0.09
R4923:Ptprc UTSW 1 138,006,236 (GRCm39) missense possibly damaging 0.93
R4925:Ptprc UTSW 1 138,027,235 (GRCm39) missense probably benign 0.04
R4937:Ptprc UTSW 1 138,017,238 (GRCm39) missense probably damaging 1.00
R4970:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5112:Ptprc UTSW 1 138,022,037 (GRCm39) missense probably damaging 0.97
R5145:Ptprc UTSW 1 138,017,304 (GRCm39) missense probably benign 0.07
R5158:Ptprc UTSW 1 138,102,822 (GRCm39) missense possibly damaging 0.75
R5223:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R5593:Ptprc UTSW 1 138,045,458 (GRCm39) intron probably benign
R5689:Ptprc UTSW 1 138,045,515 (GRCm39) missense probably benign 0.01
R5885:Ptprc UTSW 1 138,016,246 (GRCm39) missense probably damaging 1.00
R6010:Ptprc UTSW 1 138,028,794 (GRCm39) missense probably benign 0.09
R6026:Ptprc UTSW 1 137,998,987 (GRCm39) missense probably damaging 0.98
R6047:Ptprc UTSW 1 138,028,779 (GRCm39) critical splice donor site probably null
R6173:Ptprc UTSW 1 137,995,628 (GRCm39) missense probably damaging 1.00
R6328:Ptprc UTSW 1 138,041,416 (GRCm39) nonsense probably null
R6383:Ptprc UTSW 1 138,006,189 (GRCm39) missense possibly damaging 0.92
R6436:Ptprc UTSW 1 138,011,377 (GRCm39) missense possibly damaging 0.77
R6492:Ptprc UTSW 1 138,041,300 (GRCm39) critical splice donor site probably null
R6520:Ptprc UTSW 1 138,007,881 (GRCm39) nonsense probably null
R6805:Ptprc UTSW 1 137,995,623 (GRCm39) critical splice donor site probably null
R6830:Ptprc UTSW 1 137,999,993 (GRCm39) critical splice donor site probably null
R6847:Ptprc UTSW 1 138,016,283 (GRCm39) missense probably damaging 0.99
R6960:Ptprc UTSW 1 138,006,183 (GRCm39) critical splice donor site probably null
R6995:Ptprc UTSW 1 138,016,482 (GRCm39) missense probably damaging 1.00
R7009:Ptprc UTSW 1 137,992,291 (GRCm39) missense probably damaging 0.97
R7041:Ptprc UTSW 1 138,054,047 (GRCm39) missense probably benign 0.04
R7055:Ptprc UTSW 1 138,017,309 (GRCm39) missense probably damaging 1.00
R7098:Ptprc UTSW 1 138,027,423 (GRCm39) missense probably benign
R7164:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7188:Ptprc UTSW 1 137,998,918 (GRCm39) missense probably damaging 1.00
R7191:Ptprc UTSW 1 138,028,782 (GRCm39) missense probably benign 0.02
R7204:Ptprc UTSW 1 138,045,600 (GRCm39) missense probably benign
R7316:Ptprc UTSW 1 137,992,509 (GRCm39) missense probably damaging 1.00
R7948:Ptprc UTSW 1 137,992,314 (GRCm39) missense probably benign 0.45
R8029:Ptprc UTSW 1 138,006,197 (GRCm39) missense probably damaging 1.00
R8677:Ptprc UTSW 1 138,011,335 (GRCm39) missense probably damaging 1.00
R8704:Ptprc UTSW 1 138,043,362 (GRCm39) missense probably benign 0.34
R8824:Ptprc UTSW 1 138,041,446 (GRCm39) nonsense probably null
R8921:Ptprc UTSW 1 138,054,039 (GRCm39) critical splice donor site probably null
R8998:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R8999:Ptprc UTSW 1 138,028,930 (GRCm39) missense probably damaging 0.97
R9154:Ptprc UTSW 1 138,016,302 (GRCm39) missense probably damaging 1.00
R9388:Ptprc UTSW 1 138,011,380 (GRCm39) missense possibly damaging 0.87
R9428:Ptprc UTSW 1 138,041,485 (GRCm39) missense probably benign 0.01
R9467:Ptprc UTSW 1 137,993,960 (GRCm39) missense probably damaging 1.00
R9468:Ptprc UTSW 1 138,044,754 (GRCm39) missense probably benign 0.01
R9479:Ptprc UTSW 1 138,001,388 (GRCm39) missense probably benign 0.38
R9526:Ptprc UTSW 1 137,996,111 (GRCm39) missense probably benign 0.02
R9632:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9710:Ptprc UTSW 1 138,008,627 (GRCm39) missense probably damaging 1.00
R9714:Ptprc UTSW 1 138,008,687 (GRCm39) missense probably damaging 1.00
R9777:Ptprc UTSW 1 138,047,901 (GRCm39) missense
Z1177:Ptprc UTSW 1 137,995,645 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCAAATGATAGGCAGCAGCTAC -3'
(R):5'- CTTCACCTCGGATTGCAGAG -3'

Sequencing Primer
(F):5'- GCTACCAGCCTAAAAGCCTGG -3'
(R):5'- GGAAGGAGCCCAGAACTGTGTAC -3'
Posted On 2019-10-24