Incidental Mutation 'R7644:Hat1'
ID590395
Institutional Source Beutler Lab
Gene Symbol Hat1
Ensembl Gene ENSMUSG00000027018
Gene Namehistone aminotransferase 1
Synonyms2410071B14Rik, KAT1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location71388958-71441622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71410181 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 73 (L73Q)
Ref Sequence ENSEMBL: ENSMUSP00000028408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028408] [ENSMUST00000112122]
Predicted Effect probably damaging
Transcript: ENSMUST00000028408
AA Change: L73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028408
Gene: ENSMUSG00000027018
AA Change: L73Q

DomainStartEndE-ValueType
Pfam:Hat1_N 23 184 1.3e-49 PFAM
coiled coil region 386 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112122
AA Change: L73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107750
Gene: ENSMUSG00000027018
AA Change: L73Q

DomainStartEndE-ValueType
Pfam:Hat1_N 22 184 4.4e-49 PFAM
coiled coil region 393 423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal, perinatal and neonatal lethality with impaired lung maturation, atelectasis, respiratory failure, craniofacial defects and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Hat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Hat1 APN 2 71421260 missense probably damaging 1.00
IGL02945:Hat1 APN 2 71420693 missense probably benign 0.01
IGL02796:Hat1 UTSW 2 71420356 critical splice donor site probably null
R0789:Hat1 UTSW 2 71421744 splice site probably benign
R0907:Hat1 UTSW 2 71420617 nonsense probably null
R1412:Hat1 UTSW 2 71420617 nonsense probably null
R1571:Hat1 UTSW 2 71434175 missense probably benign
R1868:Hat1 UTSW 2 71421283 nonsense probably null
R1981:Hat1 UTSW 2 71389977 missense probably benign 0.01
R2064:Hat1 UTSW 2 71410160 missense possibly damaging 0.71
R2089:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R4115:Hat1 UTSW 2 71441222 missense probably benign 0.01
R5579:Hat1 UTSW 2 71410238 missense possibly damaging 0.86
R5650:Hat1 UTSW 2 71434034 missense probably benign 0.12
R5681:Hat1 UTSW 2 71434209 splice site probably null
R5895:Hat1 UTSW 2 71409013 missense possibly damaging 0.67
R6075:Hat1 UTSW 2 71410241 missense probably benign 0.29
R6621:Hat1 UTSW 2 71421715 missense probably benign 0.00
R7155:Hat1 UTSW 2 71421251 missense possibly damaging 0.95
R7506:Hat1 UTSW 2 71420347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCTTCAATATGTCCTGGGATG -3'
(R):5'- ACACTTCCTCATCCTGAAGC -3'

Sequencing Primer
(F):5'- CCTGGGATGTAGTTTAACTTCACAG -3'
(R):5'- CAGCCTGGTCTACAAAGTGAGTTC -3'
Posted On2019-10-24