Incidental Mutation 'R7644:Rapsn'
ID590397
Institutional Source Beutler Lab
Gene Symbol Rapsn
Ensembl Gene ENSMUSG00000002104
Gene Namereceptor-associated protein of the synapse
SynonymsNraps, rapsyn, 43kDa acetylcholine receptor-associated protein, Raps
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91035620-91045729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91041954 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 211 (H211L)
Ref Sequence ENSEMBL: ENSMUSP00000054150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050323] [ENSMUST00000111445] [ENSMUST00000111446]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050323
AA Change: H211L

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054150
Gene: ENSMUSG00000002104
AA Change: H211L

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 2e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
Blast:TPR 246 279 1e-14 BLAST
TPR 286 319 2.07e1 SMART
RING 363 402 2.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111445
AA Change: H211L

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107072
Gene: ENSMUSG00000002104
AA Change: H211L

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
TPR 163 196 8.29e0 SMART
TPR 206 239 1.24e0 SMART
RING 304 343 2.67e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111446
SMART Domains Protein: ENSMUSP00000107073
Gene: ENSMUSG00000002104

DomainStartEndE-ValueType
TPR 6 39 5.62e1 SMART
Blast:TPR 43 74 1e-10 BLAST
TPR 83 116 2.56e1 SMART
TPR 123 156 1.11e-2 SMART
Blast:TPR 193 226 9e-15 BLAST
TPR 233 266 2.07e1 SMART
RING 310 349 2.67e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit absence of acetylcholine receptor clusters at end plate band of neuromuscular synapses, muscle weakness, and respiratory distress leading to lethality within hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Rapsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rapsn APN 2 91035860 missense probably damaging 1.00
IGL01386:Rapsn APN 2 91036799 missense probably damaging 1.00
IGL01517:Rapsn APN 2 91036618 missense probably damaging 1.00
IGL01707:Rapsn APN 2 91043240 missense probably benign 0.03
IGL02322:Rapsn APN 2 91041906 missense possibly damaging 0.80
IGL02800:Rapsn APN 2 91043239 missense probably benign
rasputin UTSW 2 91035924 missense probably damaging 1.00
R0744:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0833:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R0836:Rapsn UTSW 2 91036808 missense probably damaging 0.99
R1224:Rapsn UTSW 2 91043198 missense probably damaging 1.00
R1294:Rapsn UTSW 2 91036775 nonsense probably null
R1619:Rapsn UTSW 2 91043159 missense possibly damaging 0.84
R2891:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2892:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R2893:Rapsn UTSW 2 91036824 missense probably damaging 0.98
R4135:Rapsn UTSW 2 91036817 missense probably damaging 0.99
R4515:Rapsn UTSW 2 91043212 missense possibly damaging 0.91
R5689:Rapsn UTSW 2 91035924 missense probably damaging 1.00
R5860:Rapsn UTSW 2 91045514 missense probably damaging 1.00
R5953:Rapsn UTSW 2 91041963 missense probably benign 0.04
R6495:Rapsn UTSW 2 91036628 missense probably damaging 1.00
R7775:Rapsn UTSW 2 91044948 missense probably benign 0.02
R7778:Rapsn UTSW 2 91044948 missense probably benign 0.02
R7896:Rapsn UTSW 2 91044955 missense probably benign 0.06
R7979:Rapsn UTSW 2 91044955 missense probably benign 0.06
X0064:Rapsn UTSW 2 91043003 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCCCTGGCTGTCACAGATC -3'
(R):5'- TTTTCAAAGTGGTCCACAGAGGC -3'

Sequencing Primer
(F):5'- TGTCACAGATCCCAGGCCTG -3'
(R):5'- ACAGAGAAGCTCCTGGCC -3'
Posted On2019-10-24