Incidental Mutation 'R7644:Fat4'
ID 590399
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
MMRRC Submission 045723-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7644 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 38941089-39066134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39064390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 4782 (E4782G)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061260
AA Change: E4782G

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: E4782G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,687,966 (GRCm39) R209Q possibly damaging Het
Abl2 A G 1: 156,443,563 (GRCm39) D24G probably benign Het
Adar C T 3: 89,652,826 (GRCm39) A754V probably benign Het
Adcy8 C T 15: 64,571,218 (GRCm39) V1172I possibly damaging Het
Adgrl2 C T 3: 148,544,789 (GRCm39) V769M probably damaging Het
Akna T A 4: 63,313,634 (GRCm39) Q163L possibly damaging Het
Alox15 C T 11: 70,236,368 (GRCm39) A511T probably null Het
Ano8 C T 8: 71,937,474 (GRCm39) G90D probably damaging Het
Aqp5 G A 15: 99,492,107 (GRCm39) R235H probably damaging Het
B3galt4 A T 17: 34,169,419 (GRCm39) V273E probably damaging Het
Ccdc125 C T 13: 100,814,884 (GRCm39) probably null Het
Ccdc90b A G 7: 92,216,868 (GRCm39) R47G possibly damaging Het
Celsr2 G T 3: 108,320,806 (GRCm39) L669I probably damaging Het
Clasp1 T G 1: 118,440,480 (GRCm39) probably null Het
Clec4a2 C T 6: 123,101,974 (GRCm39) P43L probably benign Het
Cntn1 T C 15: 92,207,890 (GRCm39) I827T probably benign Het
Col9a1 G T 1: 24,224,243 (GRCm39) V142F unknown Het
Cplane1 T A 15: 8,252,611 (GRCm39) D1944E probably benign Het
Cts7 G T 13: 61,504,782 (GRCm39) Y23* probably null Het
Dcdc2a T A 13: 25,291,674 (GRCm39) Y220N probably damaging Het
Dennd2b A T 7: 109,156,000 (GRCm39) L250* probably null Het
Dmxl1 T G 18: 50,026,619 (GRCm39) V1909G probably benign Het
Ehd2 G A 7: 15,691,474 (GRCm39) P286L possibly damaging Het
Elf3 G T 1: 135,184,244 (GRCm39) A208E possibly damaging Het
Eml5 A G 12: 98,822,203 (GRCm39) I775T probably benign Het
Ephb1 T C 9: 101,813,393 (GRCm39) T791A probably damaging Het
Fanci C A 7: 79,094,219 (GRCm39) S1105* probably null Het
Fastkd1 T A 2: 69,527,184 (GRCm39) probably null Het
Fnta T C 8: 26,503,516 (GRCm39) I90V probably damaging Het
Fosl1 C T 19: 5,500,332 (GRCm39) R84* probably null Het
Gdf2 T C 14: 33,666,847 (GRCm39) F190L probably benign Het
Gzmn T A 14: 56,404,776 (GRCm39) Q88L probably damaging Het
Hat1 T A 2: 71,240,525 (GRCm39) L73Q probably damaging Het
Hdhd2 G A 18: 77,031,871 (GRCm39) G109E possibly damaging Het
Il22ra1 A G 4: 135,460,346 (GRCm39) N34S probably damaging Het
Ino80d T C 1: 63,097,930 (GRCm39) T760A probably benign Het
Itga7 A G 10: 128,789,370 (GRCm39) D971G probably benign Het
Kdm6b T C 11: 69,291,032 (GRCm39) N1574S unknown Het
Kel T C 6: 41,667,742 (GRCm39) E400G probably benign Het
Kif22 G A 7: 126,632,134 (GRCm39) T350I probably damaging Het
Kif26b A G 1: 178,506,839 (GRCm39) N305S probably benign Het
Klk12 A C 7: 43,419,134 (GRCm39) Q33P probably damaging Het
Klk1b24 G A 7: 43,841,304 (GRCm39) probably null Het
Krtap31-1 T A 11: 99,799,048 (GRCm39) C84S possibly damaging Het
Ky T A 9: 102,414,972 (GRCm39) S295T probably benign Het
Lpin3 T A 2: 160,738,690 (GRCm39) M214K probably benign Het
Mak T A 13: 41,183,586 (GRCm39) N565Y probably benign Het
Mphosph6 T C 8: 118,528,623 (GRCm39) T7A probably benign Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Myh11 T C 16: 14,039,688 (GRCm39) T814A Het
Nmbr T C 10: 14,636,433 (GRCm39) L134P probably damaging Het
Nup107 C T 10: 117,606,375 (GRCm39) V456M probably damaging Het
Or56b1b A G 7: 108,164,649 (GRCm39) S118P possibly damaging Het
Or8g22 C A 9: 38,958,638 (GRCm39) D26Y probably damaging Het
Pink1 A T 4: 138,044,683 (GRCm39) H351Q probably damaging Het
Piwil4 A T 9: 14,645,711 (GRCm39) probably null Het
Pkd1l1 C A 11: 8,825,758 (GRCm39) V1498F Het
Polb A G 8: 23,130,443 (GRCm39) I161T probably benign Het
Polg A T 7: 79,101,416 (GRCm39) L1097Q probably damaging Het
Prelp T C 1: 133,842,356 (GRCm39) N263S probably benign Het
Pten T C 19: 32,789,234 (GRCm39) C211R probably damaging Het
Ptprc G A 1: 137,995,645 (GRCm39) A1012V probably benign Het
Ptprr T A 10: 115,884,133 (GRCm39) H63Q probably benign Het
Rapsn A T 2: 90,872,299 (GRCm39) H211L possibly damaging Het
Reln T C 5: 22,183,929 (GRCm39) N1690S probably benign Het
Rpap2 A G 5: 107,768,167 (GRCm39) E335G probably benign Het
Rspry1 T A 8: 95,385,396 (GRCm39) S567T probably benign Het
Sf3b1 G A 1: 55,036,302 (GRCm39) R924* probably null Het
Sftpb G A 6: 72,286,818 (GRCm39) E241K probably benign Het
Smarca4 G T 9: 21,566,950 (GRCm39) A677S probably benign Het
Srrm2 G A 17: 24,038,294 (GRCm39) R1646Q unknown Het
Tex15 T A 8: 34,064,445 (GRCm39) C1292S probably benign Het
Tmem140 A G 6: 34,849,708 (GRCm39) I75V probably benign Het
Trhr2 T A 8: 123,084,061 (GRCm39) Q313L possibly damaging Het
Trim35 A G 14: 66,534,546 (GRCm39) T10A unknown Het
Ttn T C 2: 76,750,124 (GRCm39) I3642V probably benign Het
Ugt1a2 T C 1: 88,128,507 (GRCm39) L50P probably damaging Het
Unc13a C A 8: 72,087,182 (GRCm39) V1522L probably benign Het
Usp33 A G 3: 152,063,589 (GRCm39) D21G possibly damaging Het
Vmn1r90 G A 7: 14,295,616 (GRCm39) Q161* probably null Het
Vmn2r117 A T 17: 23,696,265 (GRCm39) W381R probably damaging Het
Vmn2r16 G C 5: 109,487,837 (GRCm39) A237P probably damaging Het
Vmn2r74 A G 7: 85,606,746 (GRCm39) V200A probably benign Het
Yjefn3 C T 8: 70,340,544 (GRCm39) V227M probably damaging Het
Zfp652 T C 11: 95,640,914 (GRCm39) F280L probably damaging Het
Zfp748 G A 13: 67,689,568 (GRCm39) T564I probably damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 39,036,398 (GRCm39) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,943,188 (GRCm39) missense probably damaging 1.00
IGL00698:Fat4 APN 3 39,035,294 (GRCm39) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,944,822 (GRCm39) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,944,728 (GRCm39) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 39,011,418 (GRCm39) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,061,350 (GRCm39) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 39,034,807 (GRCm39) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,944,140 (GRCm39) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,941,647 (GRCm39) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,945,330 (GRCm39) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,942,219 (GRCm39) missense probably damaging 1.00
IGL01514:Fat4 APN 3 39,003,683 (GRCm39) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,063,406 (GRCm39) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,941,907 (GRCm39) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,943,096 (GRCm39) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,064,524 (GRCm39) nonsense probably null
IGL01626:Fat4 APN 3 39,005,181 (GRCm39) missense probably damaging 1.00
IGL01746:Fat4 APN 3 39,045,880 (GRCm39) nonsense probably null
IGL01800:Fat4 APN 3 39,035,878 (GRCm39) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,942,922 (GRCm39) missense probably damaging 1.00
IGL01863:Fat4 APN 3 39,024,768 (GRCm39) splice site probably benign
IGL01917:Fat4 APN 3 38,943,879 (GRCm39) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 39,033,923 (GRCm39) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,064,420 (GRCm39) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,943,348 (GRCm39) missense probably damaging 0.97
IGL02119:Fat4 APN 3 39,037,088 (GRCm39) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,942,553 (GRCm39) missense probably damaging 1.00
IGL02164:Fat4 APN 3 39,050,354 (GRCm39) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,944,695 (GRCm39) missense probably damaging 1.00
IGL02207:Fat4 APN 3 39,005,412 (GRCm39) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,946,002 (GRCm39) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,055,288 (GRCm39) missense probably benign 0.09
IGL02271:Fat4 APN 3 39,034,068 (GRCm39) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,064,137 (GRCm39) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,941,779 (GRCm39) missense probably damaging 1.00
IGL02455:Fat4 APN 3 39,005,280 (GRCm39) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 39,037,195 (GRCm39) missense probably benign
IGL02478:Fat4 APN 3 38,942,364 (GRCm39) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,064,579 (GRCm39) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,941,394 (GRCm39) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,056,913 (GRCm39) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,056,985 (GRCm39) missense probably benign 0.08
IGL02674:Fat4 APN 3 39,037,486 (GRCm39) missense probably benign 0.35
IGL02692:Fat4 APN 3 39,005,235 (GRCm39) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,944,744 (GRCm39) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,943,444 (GRCm39) missense probably damaging 1.00
IGL02834:Fat4 APN 3 39,010,893 (GRCm39) missense probably damaging 1.00
IGL02891:Fat4 APN 3 39,005,422 (GRCm39) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,944,992 (GRCm39) missense probably damaging 1.00
IGL02993:Fat4 APN 3 39,011,304 (GRCm39) missense probably damaging 1.00
IGL02996:Fat4 APN 3 39,012,674 (GRCm39) missense probably damaging 1.00
IGL03029:Fat4 APN 3 39,036,740 (GRCm39) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 39,035,701 (GRCm39) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 39,011,008 (GRCm39) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 39,045,834 (GRCm39) missense probably damaging 1.00
IGL03169:Fat4 APN 3 39,011,547 (GRCm39) missense probably benign 0.02
IGL03190:Fat4 APN 3 39,035,390 (GRCm39) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,063,852 (GRCm39) missense probably benign
IGL03371:Fat4 APN 3 39,037,336 (GRCm39) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,943,283 (GRCm39) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 39,011,376 (GRCm39) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,946,168 (GRCm39) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,063,513 (GRCm39) missense probably damaging 1.00
IGL03405:Fat4 APN 3 39,012,599 (GRCm39) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,945,325 (GRCm39) missense probably damaging 1.00
Asahi UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
Expulsion UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
heineken UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
schlitz UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 39,036,506 (GRCm39) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,943,153 (GRCm39) missense probably benign 0.04
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,943,080 (GRCm39) missense probably benign 0.35
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,945,745 (GRCm39) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,944,965 (GRCm39) missense probably benign
R0357:Fat4 UTSW 3 38,945,376 (GRCm39) missense probably damaging 1.00
R0409:Fat4 UTSW 3 39,031,562 (GRCm39) missense probably damaging 1.00
R0498:Fat4 UTSW 3 39,034,786 (GRCm39) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,057,073 (GRCm39) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,942,463 (GRCm39) missense probably benign 0.00
R0532:Fat4 UTSW 3 39,035,870 (GRCm39) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,997,019 (GRCm39) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,054,321 (GRCm39) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,943,843 (GRCm39) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,055,327 (GRCm39) missense probably benign
R0729:Fat4 UTSW 3 39,054,444 (GRCm39) splice site probably benign
R0748:Fat4 UTSW 3 38,941,977 (GRCm39) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0812:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0830:Fat4 UTSW 3 39,053,258 (GRCm39) missense probably benign 0.26
R0841:Fat4 UTSW 3 39,050,147 (GRCm39) missense probably damaging 0.99
R0884:Fat4 UTSW 3 39,037,007 (GRCm39) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,945,541 (GRCm39) missense probably damaging 1.00
R1066:Fat4 UTSW 3 39,011,376 (GRCm39) missense probably damaging 1.00
R1078:Fat4 UTSW 3 39,037,235 (GRCm39) missense probably benign 0.10
R1084:Fat4 UTSW 3 39,033,974 (GRCm39) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 39,037,091 (GRCm39) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,944,520 (GRCm39) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,944,962 (GRCm39) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,942,472 (GRCm39) missense probably damaging 1.00
R1487:Fat4 UTSW 3 39,050,066 (GRCm39) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 39,037,225 (GRCm39) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,944,238 (GRCm39) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,943,135 (GRCm39) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,943,009 (GRCm39) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,061,326 (GRCm39) missense probably damaging 0.99
R1655:Fat4 UTSW 3 39,011,467 (GRCm39) missense probably damaging 0.97
R1662:Fat4 UTSW 3 39,034,928 (GRCm39) missense probably damaging 1.00
R1710:Fat4 UTSW 3 39,005,304 (GRCm39) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,945,459 (GRCm39) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,941,638 (GRCm39) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,064,417 (GRCm39) missense probably damaging 1.00
R1828:Fat4 UTSW 3 39,037,607 (GRCm39) missense probably damaging 1.00
R1835:Fat4 UTSW 3 39,037,720 (GRCm39) missense probably benign 0.00
R1846:Fat4 UTSW 3 39,036,532 (GRCm39) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,064,633 (GRCm39) missense probably benign 0.09
R1871:Fat4 UTSW 3 39,035,221 (GRCm39) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 39,045,813 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 39,050,239 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,941,264 (GRCm39) missense probably benign
R2056:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,064,804 (GRCm39) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,943,822 (GRCm39) missense probably damaging 1.00
R2114:Fat4 UTSW 3 39,035,633 (GRCm39) missense probably benign 0.01
R2135:Fat4 UTSW 3 39,034,882 (GRCm39) missense probably damaging 0.98
R2152:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2153:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,941,688 (GRCm39) missense probably damaging 1.00
R2196:Fat4 UTSW 3 39,035,566 (GRCm39) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,945,676 (GRCm39) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,064,364 (GRCm39) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,946,198 (GRCm39) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,943,138 (GRCm39) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,944,571 (GRCm39) missense probably benign 0.25
R2274:Fat4 UTSW 3 39,050,048 (GRCm39) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 39,034,160 (GRCm39) missense probably damaging 1.00
R2343:Fat4 UTSW 3 39,011,254 (GRCm39) missense probably damaging 0.97
R2365:Fat4 UTSW 3 39,034,568 (GRCm39) missense probably benign
R2412:Fat4 UTSW 3 39,011,221 (GRCm39) missense probably benign 0.05
R2883:Fat4 UTSW 3 39,034,953 (GRCm39) missense probably damaging 1.00
R2942:Fat4 UTSW 3 39,036,485 (GRCm39) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,061,302 (GRCm39) missense probably benign
R3103:Fat4 UTSW 3 38,946,089 (GRCm39) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,944,940 (GRCm39) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 39,035,423 (GRCm39) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 39,036,587 (GRCm39) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3957:Fat4 UTSW 3 39,036,495 (GRCm39) missense probably benign
R4065:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign 0.13
R4078:Fat4 UTSW 3 39,034,169 (GRCm39) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,942,024 (GRCm39) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,996,958 (GRCm39) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,943,320 (GRCm39) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,945,912 (GRCm39) missense probably damaging 1.00
R4407:Fat4 UTSW 3 39,012,689 (GRCm39) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,945,443 (GRCm39) missense probably benign 0.01
R4547:Fat4 UTSW 3 39,005,432 (GRCm39) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,941,491 (GRCm39) missense probably damaging 1.00
R4826:Fat4 UTSW 3 39,037,106 (GRCm39) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,942,466 (GRCm39) missense probably benign
R4871:Fat4 UTSW 3 38,945,754 (GRCm39) missense probably damaging 1.00
R4897:Fat4 UTSW 3 39,034,781 (GRCm39) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,064,614 (GRCm39) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,061,352 (GRCm39) missense probably benign 0.00
R4941:Fat4 UTSW 3 39,011,601 (GRCm39) missense probably damaging 1.00
R4943:Fat4 UTSW 3 39,034,322 (GRCm39) missense probably benign 0.19
R4959:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R4973:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,942,438 (GRCm39) missense probably benign 0.34
R5163:Fat4 UTSW 3 39,034,946 (GRCm39) missense probably damaging 1.00
R5213:Fat4 UTSW 3 39,034,340 (GRCm39) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 39,011,017 (GRCm39) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,064,527 (GRCm39) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,942,154 (GRCm39) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,943,013 (GRCm39) missense probably damaging 1.00
R5384:Fat4 UTSW 3 39,050,095 (GRCm39) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,941,394 (GRCm39) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,945,495 (GRCm39) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,064,519 (GRCm39) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,941,364 (GRCm39) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,064,423 (GRCm39) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,943,083 (GRCm39) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,057,117 (GRCm39) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,943,774 (GRCm39) missense probably damaging 1.00
R5735:Fat4 UTSW 3 39,003,725 (GRCm39) missense probably damaging 1.00
R5739:Fat4 UTSW 3 39,037,283 (GRCm39) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,943,617 (GRCm39) missense probably damaging 1.00
R5780:Fat4 UTSW 3 39,035,104 (GRCm39) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,945,936 (GRCm39) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,061,454 (GRCm39) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,941,485 (GRCm39) missense probably benign
R5933:Fat4 UTSW 3 39,005,524 (GRCm39) critical splice donor site probably null
R5938:Fat4 UTSW 3 39,005,388 (GRCm39) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
R5945:Fat4 UTSW 3 39,037,355 (GRCm39) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,064,696 (GRCm39) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,056,951 (GRCm39) missense probably damaging 1.00
R6158:Fat4 UTSW 3 39,037,411 (GRCm39) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 1.00
R6253:Fat4 UTSW 3 39,005,505 (GRCm39) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,061,395 (GRCm39) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,061,229 (GRCm39) splice site probably null
R6387:Fat4 UTSW 3 39,037,934 (GRCm39) missense probably damaging 1.00
R6390:Fat4 UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
R6456:Fat4 UTSW 3 39,038,128 (GRCm39) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,945,036 (GRCm39) missense probably damaging 1.00
R6500:Fat4 UTSW 3 39,035,418 (GRCm39) nonsense probably null
R6503:Fat4 UTSW 3 39,036,406 (GRCm39) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,057,020 (GRCm39) missense probably benign
R6566:Fat4 UTSW 3 39,011,275 (GRCm39) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 39,033,839 (GRCm39) missense probably benign
R6590:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,997,077 (GRCm39) missense probably benign 0.01
R6662:Fat4 UTSW 3 39,010,970 (GRCm39) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6807:Fat4 UTSW 3 39,036,589 (GRCm39) missense probably benign 0.18
R6823:Fat4 UTSW 3 39,038,088 (GRCm39) missense probably benign 0.05
R6824:Fat4 UTSW 3 39,011,674 (GRCm39) missense probably benign 0.00
R6830:Fat4 UTSW 3 39,035,966 (GRCm39) missense probably benign 0.00
R6925:Fat4 UTSW 3 39,050,353 (GRCm39) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,063,595 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,050,120 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,035,924 (GRCm39) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,945,692 (GRCm39) missense probably benign
R7030:Fat4 UTSW 3 39,036,107 (GRCm39) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,064,960 (GRCm39) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,064,959 (GRCm39) missense probably benign
R7045:Fat4 UTSW 3 38,942,750 (GRCm39) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,944,023 (GRCm39) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,064,682 (GRCm39) missense probably damaging 1.00
R7130:Fat4 UTSW 3 39,034,936 (GRCm39) missense probably damaging 0.99
R7168:Fat4 UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
R7192:Fat4 UTSW 3 39,034,613 (GRCm39) missense probably benign 0.04
R7194:Fat4 UTSW 3 39,038,044 (GRCm39) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,943,033 (GRCm39) missense probably damaging 1.00
R7199:Fat4 UTSW 3 39,031,511 (GRCm39) missense probably damaging 0.98
R7213:Fat4 UTSW 3 39,053,236 (GRCm39) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,945,192 (GRCm39) missense probably damaging 1.00
R7225:Fat4 UTSW 3 39,034,325 (GRCm39) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,944,562 (GRCm39) missense probably benign 0.31
R7239:Fat4 UTSW 3 39,037,989 (GRCm39) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,943,842 (GRCm39) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,943,294 (GRCm39) nonsense probably null
R7372:Fat4 UTSW 3 38,944,358 (GRCm39) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,942,073 (GRCm39) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,054,385 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,063,793 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,941,599 (GRCm39) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,063,306 (GRCm39) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 39,011,576 (GRCm39) nonsense probably null
R7501:Fat4 UTSW 3 39,012,597 (GRCm39) nonsense probably null
R7533:Fat4 UTSW 3 39,061,406 (GRCm39) missense probably benign 0.43
R7542:Fat4 UTSW 3 39,035,770 (GRCm39) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 39,035,504 (GRCm39) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 39,035,263 (GRCm39) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,943,485 (GRCm39) missense probably damaging 1.00
R7660:Fat4 UTSW 3 39,035,309 (GRCm39) missense probably benign
R7665:Fat4 UTSW 3 38,943,327 (GRCm39) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,945,846 (GRCm39) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,055,353 (GRCm39) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,942,000 (GRCm39) missense probably benign
R7883:Fat4 UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
R7892:Fat4 UTSW 3 39,003,588 (GRCm39) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,941,690 (GRCm39) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 0.98
R8015:Fat4 UTSW 3 39,036,065 (GRCm39) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 39,035,815 (GRCm39) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,945,352 (GRCm39) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,946,203 (GRCm39) missense probably damaging 0.99
R8163:Fat4 UTSW 3 39,033,881 (GRCm39) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 39,012,659 (GRCm39) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,063,128 (GRCm39) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 39,033,824 (GRCm39) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 39,035,702 (GRCm39) missense probably benign 0.25
R8509:Fat4 UTSW 3 39,036,052 (GRCm39) missense probably benign
R8543:Fat4 UTSW 3 39,031,643 (GRCm39) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,064,842 (GRCm39) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,064,647 (GRCm39) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,942,592 (GRCm39) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,946,002 (GRCm39) missense probably benign 0.01
R8779:Fat4 UTSW 3 39,033,898 (GRCm39) missense probably damaging 1.00
R8797:Fat4 UTSW 3 39,053,278 (GRCm39) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,946,269 (GRCm39) missense probably benign 0.26
R8955:Fat4 UTSW 3 39,037,778 (GRCm39) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,941,324 (GRCm39) nonsense probably null
R9071:Fat4 UTSW 3 39,037,598 (GRCm39) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,061,448 (GRCm39) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,064,803 (GRCm39) missense
R9180:Fat4 UTSW 3 38,942,556 (GRCm39) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 39,036,592 (GRCm39) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,945,079 (GRCm39) missense probably damaging 1.00
R9206:Fat4 UTSW 3 39,063,390 (GRCm39) missense probably damaging 0.99
R9268:Fat4 UTSW 3 38,942,396 (GRCm39) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,945,171 (GRCm39) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,945,781 (GRCm39) missense probably damaging 0.98
R9355:Fat4 UTSW 3 39,036,047 (GRCm39) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,945,417 (GRCm39) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,945,412 (GRCm39) missense
R9456:Fat4 UTSW 3 38,942,571 (GRCm39) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9510:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9511:Fat4 UTSW 3 39,034,802 (GRCm39) missense probably damaging 0.98
R9540:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign
R9568:Fat4 UTSW 3 38,946,156 (GRCm39) missense probably damaging 1.00
R9646:Fat4 UTSW 3 39,035,813 (GRCm39) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,943,332 (GRCm39) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,055,374 (GRCm39) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,063,255 (GRCm39) missense probably benign 0.00
X0019:Fat4 UTSW 3 39,035,189 (GRCm39) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,054,300 (GRCm39) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,997,051 (GRCm39) missense probably benign 0.43
X0064:Fat4 UTSW 3 39,024,901 (GRCm39) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 39,012,641 (GRCm39) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,941,199 (GRCm39) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 39,037,964 (GRCm39) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 39,037,508 (GRCm39) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,944,496 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,942,733 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 39,035,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCTTCCTCTGAGGGATG -3'
(R):5'- TCCATTTCTGAGCACGTGAAAG -3'

Sequencing Primer
(F):5'- CCTCTGAGGGATGGGGGTAC -3'
(R):5'- AATCATGGGAGTCACTGTCAG -3'
Posted On 2019-10-24