Incidental Mutation 'R7644:Adgrl2'
ID590402
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Nameadhesion G protein-coupled receptor L2
SynonymsLec1, Lphn2, Lphh1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location148815583-148990555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148839153 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 769 (V769M)
Ref Sequence ENSEMBL: ENSMUSP00000143626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: V769M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: V769M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: V769M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: V769M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196526
AA Change: V752M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: V752M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: V769M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: V769M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197925
Predicted Effect probably damaging
Transcript: ENSMUST00000198779
AA Change: V769M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: V769M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: V769M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: V769M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: V769M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: V769M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199750
AA Change: V690M

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: V690M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200154
AA Change: V752M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: V752M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: V752M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: V752M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148865608 missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148826498 missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148836527 missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148858975 missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148828489 nonsense probably null
IGL02468:Adgrl2 APN 3 148890480 missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148826525 missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148890605 missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148817400 missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148859380 missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148859063 missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148817298 missense
PIT4544001:Adgrl2 UTSW 3 148890521 missense probably damaging 1.00
R0165:Adgrl2 UTSW 3 148852863 splice site probably benign
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0242:Adgrl2 UTSW 3 148839185 unclassified probably null
R0344:Adgrl2 UTSW 3 148865595 splice site probably null
R0488:Adgrl2 UTSW 3 148846905 missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148859218 missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148839244 missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148837679 missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148822981 missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148859273 missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148852762 missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148865608 missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148852593 missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148817244 missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148826475 missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148890488 missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148851934 missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148817649 missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148817551 missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148859329 missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148858963 missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148817235 missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148839152 missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148859020 missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148890463 missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148823036 missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148823713 missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148817844 missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148837562 critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148859164 missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148859175 missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148823009 missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148858942 missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148826507 missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148817286 missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148846929 missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148858949 missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148846870 missense probably benign 0.00
R7348:Adgrl2 UTSW 3 148817766 missense
R7382:Adgrl2 UTSW 3 148817283 missense
R7486:Adgrl2 UTSW 3 148817694 missense
R7498:Adgrl2 UTSW 3 148859216 nonsense probably null
R7690:Adgrl2 UTSW 3 148817298 missense
R7742:Adgrl2 UTSW 3 148836428 missense probably damaging 1.00
R7745:Adgrl2 UTSW 3 148836458 missense probably damaging 1.00
RF007:Adgrl2 UTSW 3 148839248 missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148852654 missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148865594 splice site probably null
Predicted Primers PCR Primer
(F):5'- TAAACTTGTGTCTCTGACCCAGC -3'
(R):5'- GAGTCCTATGGCTGTGTCTTCC -3'

Sequencing Primer
(F):5'- GTGTCTCTGACCCAGCCCAAC -3'
(R):5'- CTTCCTTCCTAGGGCTGGC -3'
Posted On2019-10-24