Incidental Mutation 'R7644:Fanci'
ID 590417
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene Name Fanconi anemia, complementation group I
Synonyms
MMRRC Submission 045723-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.651) question?
Stock # R7644 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79042056-79100013 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 79094219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 1105 (S1105*)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000073889] [ENSMUST00000132091] [ENSMUST00000139290]
AlphaFold Q8K368
PDB Structure Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000036865
AA Change: S1105*
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: S1105*

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073889
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect probably benign
Transcript: ENSMUST00000206121
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,687,966 (GRCm39) R209Q possibly damaging Het
Abl2 A G 1: 156,443,563 (GRCm39) D24G probably benign Het
Adar C T 3: 89,652,826 (GRCm39) A754V probably benign Het
Adcy8 C T 15: 64,571,218 (GRCm39) V1172I possibly damaging Het
Adgrl2 C T 3: 148,544,789 (GRCm39) V769M probably damaging Het
Akna T A 4: 63,313,634 (GRCm39) Q163L possibly damaging Het
Alox15 C T 11: 70,236,368 (GRCm39) A511T probably null Het
Ano8 C T 8: 71,937,474 (GRCm39) G90D probably damaging Het
Aqp5 G A 15: 99,492,107 (GRCm39) R235H probably damaging Het
B3galt4 A T 17: 34,169,419 (GRCm39) V273E probably damaging Het
Ccdc125 C T 13: 100,814,884 (GRCm39) probably null Het
Ccdc90b A G 7: 92,216,868 (GRCm39) R47G possibly damaging Het
Celsr2 G T 3: 108,320,806 (GRCm39) L669I probably damaging Het
Clasp1 T G 1: 118,440,480 (GRCm39) probably null Het
Clec4a2 C T 6: 123,101,974 (GRCm39) P43L probably benign Het
Cntn1 T C 15: 92,207,890 (GRCm39) I827T probably benign Het
Col9a1 G T 1: 24,224,243 (GRCm39) V142F unknown Het
Cplane1 T A 15: 8,252,611 (GRCm39) D1944E probably benign Het
Cts7 G T 13: 61,504,782 (GRCm39) Y23* probably null Het
Dcdc2a T A 13: 25,291,674 (GRCm39) Y220N probably damaging Het
Dennd2b A T 7: 109,156,000 (GRCm39) L250* probably null Het
Dmxl1 T G 18: 50,026,619 (GRCm39) V1909G probably benign Het
Ehd2 G A 7: 15,691,474 (GRCm39) P286L possibly damaging Het
Elf3 G T 1: 135,184,244 (GRCm39) A208E possibly damaging Het
Eml5 A G 12: 98,822,203 (GRCm39) I775T probably benign Het
Ephb1 T C 9: 101,813,393 (GRCm39) T791A probably damaging Het
Fastkd1 T A 2: 69,527,184 (GRCm39) probably null Het
Fat4 A G 3: 39,064,390 (GRCm39) E4782G possibly damaging Het
Fnta T C 8: 26,503,516 (GRCm39) I90V probably damaging Het
Fosl1 C T 19: 5,500,332 (GRCm39) R84* probably null Het
Gdf2 T C 14: 33,666,847 (GRCm39) F190L probably benign Het
Gzmn T A 14: 56,404,776 (GRCm39) Q88L probably damaging Het
Hat1 T A 2: 71,240,525 (GRCm39) L73Q probably damaging Het
Hdhd2 G A 18: 77,031,871 (GRCm39) G109E possibly damaging Het
Il22ra1 A G 4: 135,460,346 (GRCm39) N34S probably damaging Het
Ino80d T C 1: 63,097,930 (GRCm39) T760A probably benign Het
Itga7 A G 10: 128,789,370 (GRCm39) D971G probably benign Het
Kdm6b T C 11: 69,291,032 (GRCm39) N1574S unknown Het
Kel T C 6: 41,667,742 (GRCm39) E400G probably benign Het
Kif22 G A 7: 126,632,134 (GRCm39) T350I probably damaging Het
Kif26b A G 1: 178,506,839 (GRCm39) N305S probably benign Het
Klk12 A C 7: 43,419,134 (GRCm39) Q33P probably damaging Het
Klk1b24 G A 7: 43,841,304 (GRCm39) probably null Het
Krtap31-1 T A 11: 99,799,048 (GRCm39) C84S possibly damaging Het
Ky T A 9: 102,414,972 (GRCm39) S295T probably benign Het
Lpin3 T A 2: 160,738,690 (GRCm39) M214K probably benign Het
Mak T A 13: 41,183,586 (GRCm39) N565Y probably benign Het
Mphosph6 T C 8: 118,528,623 (GRCm39) T7A probably benign Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Myh11 T C 16: 14,039,688 (GRCm39) T814A Het
Nmbr T C 10: 14,636,433 (GRCm39) L134P probably damaging Het
Nup107 C T 10: 117,606,375 (GRCm39) V456M probably damaging Het
Or56b1b A G 7: 108,164,649 (GRCm39) S118P possibly damaging Het
Or8g22 C A 9: 38,958,638 (GRCm39) D26Y probably damaging Het
Pink1 A T 4: 138,044,683 (GRCm39) H351Q probably damaging Het
Piwil4 A T 9: 14,645,711 (GRCm39) probably null Het
Pkd1l1 C A 11: 8,825,758 (GRCm39) V1498F Het
Polb A G 8: 23,130,443 (GRCm39) I161T probably benign Het
Polg A T 7: 79,101,416 (GRCm39) L1097Q probably damaging Het
Prelp T C 1: 133,842,356 (GRCm39) N263S probably benign Het
Pten T C 19: 32,789,234 (GRCm39) C211R probably damaging Het
Ptprc G A 1: 137,995,645 (GRCm39) A1012V probably benign Het
Ptprr T A 10: 115,884,133 (GRCm39) H63Q probably benign Het
Rapsn A T 2: 90,872,299 (GRCm39) H211L possibly damaging Het
Reln T C 5: 22,183,929 (GRCm39) N1690S probably benign Het
Rpap2 A G 5: 107,768,167 (GRCm39) E335G probably benign Het
Rspry1 T A 8: 95,385,396 (GRCm39) S567T probably benign Het
Sf3b1 G A 1: 55,036,302 (GRCm39) R924* probably null Het
Sftpb G A 6: 72,286,818 (GRCm39) E241K probably benign Het
Smarca4 G T 9: 21,566,950 (GRCm39) A677S probably benign Het
Srrm2 G A 17: 24,038,294 (GRCm39) R1646Q unknown Het
Tex15 T A 8: 34,064,445 (GRCm39) C1292S probably benign Het
Tmem140 A G 6: 34,849,708 (GRCm39) I75V probably benign Het
Trhr2 T A 8: 123,084,061 (GRCm39) Q313L possibly damaging Het
Trim35 A G 14: 66,534,546 (GRCm39) T10A unknown Het
Ttn T C 2: 76,750,124 (GRCm39) I3642V probably benign Het
Ugt1a2 T C 1: 88,128,507 (GRCm39) L50P probably damaging Het
Unc13a C A 8: 72,087,182 (GRCm39) V1522L probably benign Het
Usp33 A G 3: 152,063,589 (GRCm39) D21G possibly damaging Het
Vmn1r90 G A 7: 14,295,616 (GRCm39) Q161* probably null Het
Vmn2r117 A T 17: 23,696,265 (GRCm39) W381R probably damaging Het
Vmn2r16 G C 5: 109,487,837 (GRCm39) A237P probably damaging Het
Vmn2r74 A G 7: 85,606,746 (GRCm39) V200A probably benign Het
Yjefn3 C T 8: 70,340,544 (GRCm39) V227M probably damaging Het
Zfp652 T C 11: 95,640,914 (GRCm39) F280L probably damaging Het
Zfp748 G A 13: 67,689,568 (GRCm39) T564I probably damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79,062,448 (GRCm39) missense probably damaging 1.00
IGL00718:Fanci APN 7 79,093,922 (GRCm39) missense possibly damaging 0.92
IGL00764:Fanci APN 7 79,045,660 (GRCm39) start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79,098,925 (GRCm39) missense probably benign 0.01
IGL02338:Fanci APN 7 79,083,279 (GRCm39) nonsense probably null
IGL02428:Fanci APN 7 79,094,264 (GRCm39) intron probably benign
IGL03029:Fanci APN 7 79,093,747 (GRCm39) missense probably benign 0.00
BB005:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
BB015:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
P0023:Fanci UTSW 7 79,052,048 (GRCm39) missense probably benign 0.00
P0047:Fanci UTSW 7 79,093,792 (GRCm39) missense probably damaging 1.00
R0310:Fanci UTSW 7 79,057,165 (GRCm39) splice site probably benign
R0388:Fanci UTSW 7 79,089,378 (GRCm39) missense probably benign
R0506:Fanci UTSW 7 79,081,926 (GRCm39) missense probably benign 0.29
R0570:Fanci UTSW 7 79,093,711 (GRCm39) missense probably damaging 1.00
R0631:Fanci UTSW 7 79,055,953 (GRCm39) missense probably damaging 1.00
R0746:Fanci UTSW 7 79,089,429 (GRCm39) missense probably damaging 0.99
R0981:Fanci UTSW 7 79,054,914 (GRCm39) missense probably benign 0.01
R1559:Fanci UTSW 7 79,082,941 (GRCm39) missense probably damaging 1.00
R1656:Fanci UTSW 7 79,054,936 (GRCm39) splice site probably benign
R1748:Fanci UTSW 7 79,080,236 (GRCm39) missense probably damaging 1.00
R1815:Fanci UTSW 7 79,088,056 (GRCm39) missense probably damaging 1.00
R2164:Fanci UTSW 7 79,045,743 (GRCm39) missense probably benign 0.22
R3508:Fanci UTSW 7 79,083,220 (GRCm39) missense probably benign 0.01
R3908:Fanci UTSW 7 79,083,257 (GRCm39) missense possibly damaging 0.91
R4036:Fanci UTSW 7 79,094,570 (GRCm39) missense probably damaging 1.00
R4066:Fanci UTSW 7 79,062,505 (GRCm39) critical splice donor site probably null
R4633:Fanci UTSW 7 79,076,990 (GRCm39) missense probably damaging 1.00
R4651:Fanci UTSW 7 79,085,004 (GRCm39) missense possibly damaging 0.74
R4993:Fanci UTSW 7 79,085,126 (GRCm39) makesense probably null
R5341:Fanci UTSW 7 79,055,926 (GRCm39) missense probably damaging 1.00
R5806:Fanci UTSW 7 79,098,596 (GRCm39) missense probably damaging 0.97
R5898:Fanci UTSW 7 79,083,069 (GRCm39) missense probably benign
R5919:Fanci UTSW 7 79,094,486 (GRCm39) missense probably damaging 1.00
R5960:Fanci UTSW 7 79,093,510 (GRCm39) missense probably damaging 1.00
R6367:Fanci UTSW 7 79,075,943 (GRCm39) missense probably damaging 0.99
R6436:Fanci UTSW 7 79,090,446 (GRCm39) missense probably benign 0.03
R6468:Fanci UTSW 7 79,067,687 (GRCm39) missense probably benign 0.10
R6508:Fanci UTSW 7 79,093,516 (GRCm39) missense probably damaging 0.99
R6886:Fanci UTSW 7 79,070,090 (GRCm39) missense possibly damaging 0.81
R7554:Fanci UTSW 7 79,062,500 (GRCm39) missense probably damaging 0.99
R7588:Fanci UTSW 7 79,084,017 (GRCm39) missense possibly damaging 0.81
R7697:Fanci UTSW 7 79,056,040 (GRCm39) critical splice donor site probably null
R7732:Fanci UTSW 7 79,062,400 (GRCm39) missense possibly damaging 0.65
R7928:Fanci UTSW 7 79,094,459 (GRCm39) missense probably benign
R8170:Fanci UTSW 7 79,083,305 (GRCm39) splice site probably null
R8355:Fanci UTSW 7 79,085,029 (GRCm39) missense probably damaging 1.00
R8425:Fanci UTSW 7 79,083,289 (GRCm39) missense probably benign 0.07
R8429:Fanci UTSW 7 79,088,133 (GRCm39) missense possibly damaging 0.65
R8455:Fanci UTSW 7 79,085,029 (GRCm39) missense probably damaging 1.00
R8720:Fanci UTSW 7 79,089,425 (GRCm39) missense possibly damaging 0.92
R8786:Fanci UTSW 7 79,052,298 (GRCm39) missense probably benign 0.02
R8946:Fanci UTSW 7 79,045,726 (GRCm39) missense probably benign 0.03
R8986:Fanci UTSW 7 79,095,472 (GRCm39) missense probably benign 0.03
R9213:Fanci UTSW 7 79,055,971 (GRCm39) missense possibly damaging 0.70
R9333:Fanci UTSW 7 79,067,594 (GRCm39) missense possibly damaging 0.47
R9485:Fanci UTSW 7 79,089,405 (GRCm39) missense probably benign 0.10
R9508:Fanci UTSW 7 79,083,033 (GRCm39) missense possibly damaging 0.89
R9624:Fanci UTSW 7 79,085,117 (GRCm39) missense probably benign 0.12
R9649:Fanci UTSW 7 79,076,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTTCCATCTGAGAAGCC -3'
(R):5'- AGGCATCTTCTGAAGGGAAATG -3'

Sequencing Primer
(F):5'- TTCCATCTGAGAAGCCCGTGATAG -3'
(R):5'- GGAAATGAGATTGATGCCCTTCAGTC -3'
Posted On 2019-10-24