Incidental Mutation 'R7644:Olfr504'
ID590421
Institutional Source Beutler Lab
Gene Symbol Olfr504
Ensembl Gene ENSMUSG00000060105
Gene Nameolfactory receptor 504
SynonymsGA_x6K02T2PBJ9-10895499-10894543, MOR40-15, MOR40-7P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108564836-108565793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108565442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 118 (S118P)
Ref Sequence ENSEMBL: ENSMUSP00000075025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075595]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075595
AA Change: S118P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075025
Gene: ENSMUSG00000060105
AA Change: S118P

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.9e-70 PFAM
Pfam:7TM_GPCR_Srsx 40 311 5.1e-10 PFAM
Pfam:7tm_1 47 296 3.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Olfr504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Olfr504 APN 7 108565202 missense probably benign 0.02
IGL01447:Olfr504 APN 7 108565009 missense possibly damaging 0.75
IGL01845:Olfr504 APN 7 108565136 missense possibly damaging 0.76
IGL02110:Olfr504 APN 7 108565079 missense probably damaging 1.00
IGL03196:Olfr504 APN 7 108564854 missense probably benign
R0282:Olfr504 UTSW 7 108565477 missense probably damaging 1.00
R0359:Olfr504 UTSW 7 108565514 missense probably benign 0.01
R0514:Olfr504 UTSW 7 108565672 missense probably damaging 1.00
R0727:Olfr504 UTSW 7 108565108 missense probably benign 0.00
R0744:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0836:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0840:Olfr504 UTSW 7 108565616 missense probably benign 0.00
R0883:Olfr504 UTSW 7 108565276 missense probably benign 0.01
R1750:Olfr504 UTSW 7 108565357 nonsense probably null
R1827:Olfr504 UTSW 7 108565075 missense probably benign 0.35
R1933:Olfr504 UTSW 7 108565523 missense possibly damaging 0.57
R3004:Olfr504 UTSW 7 108564944 missense probably benign 0.42
R3766:Olfr504 UTSW 7 108565195 missense probably benign 0.00
R5179:Olfr504 UTSW 7 108565226 missense probably benign
R5408:Olfr504 UTSW 7 108565169 missense probably damaging 0.99
R5493:Olfr504 UTSW 7 108565567 missense probably benign 0.24
R5569:Olfr504 UTSW 7 108565565 missense probably benign 0.01
R6520:Olfr504 UTSW 7 108564839 makesense probably null
R6798:Olfr504 UTSW 7 108565760 nonsense probably null
R6803:Olfr504 UTSW 7 108565413 missense probably damaging 1.00
R7242:Olfr504 UTSW 7 108565712 missense probably benign 0.03
R7559:Olfr504 UTSW 7 108565556 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAACAATAATTCCACTGGGATGC -3'
(R):5'- GCAATAGGGACAAACGTGCTC -3'

Sequencing Primer
(F):5'- TTCCACTGGGATGCAAGCAC -3'
(R):5'- TAGGGACAAACGTGCTCATTCTC -3'
Posted On2019-10-24