Incidental Mutation 'R7644:St5'
ID590422
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Namesuppression of tumorigenicity 5
Synonyms2610305K15Rik, 2010004M01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R7644 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109523911-109703605 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 109556793 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 250 (L250*)
Ref Sequence ENSEMBL: ENSMUSP00000077067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]
Predicted Effect probably null
Transcript: ENSMUST00000077909
AA Change: L250*
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: L250*

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079282
AA Change: L250*
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: L250*

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084738
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168005
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207394
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Predicted Effect probably benign
Transcript: ENSMUST00000208583
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc125 C T 13: 100,678,376 probably null Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clasp1 T G 1: 118,512,750 probably null Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fastkd1 T A 2: 69,696,840 probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Hdhd2 G A 18: 76,944,175 G109E possibly damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Klk1b24 G A 7: 44,191,880 probably null Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Piwil4 A T 9: 14,734,415 probably null Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 unclassified probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCTACACTGTAGCAGCTG -3'
(R):5'- CTTCACCCAGGATGAGTCTGTG -3'

Sequencing Primer
(F):5'- GCTAGGGAGCTGGGGGAG -3'
(R):5'- CCCAGGATGAGTCTGTGTGGAG -3'
Posted On2019-10-24