Incidental Mutation 'R7644:Kif22'
ID590423
Institutional Source Beutler Lab
Gene Symbol Kif22
Ensembl Gene ENSMUSG00000030677
Gene Namekinesin family member 22
SynonymsKid, Kif22a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127027729-127042471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127032962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 350 (T350I)
Ref Sequence ENSEMBL: ENSMUSP00000032915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000205806]
Predicted Effect probably damaging
Transcript: ENSMUST00000032915
AA Change: T350I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677
AA Change: T350I

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205754
Predicted Effect probably benign
Transcript: ENSMUST00000205806
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Kif22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Kif22 APN 7 127033473 missense probably damaging 0.96
IGL01333:Kif22 APN 7 127034195 missense probably damaging 1.00
R0207:Kif22 UTSW 7 127042400 start codon destroyed probably null 0.73
R0723:Kif22 UTSW 7 127033906 missense probably damaging 1.00
R1118:Kif22 UTSW 7 127032744 missense probably benign
R1521:Kif22 UTSW 7 127027839 missense probably damaging 0.99
R2036:Kif22 UTSW 7 127030954 missense possibly damaging 0.94
R2092:Kif22 UTSW 7 127033630 missense probably damaging 0.99
R3790:Kif22 UTSW 7 127029496 missense probably damaging 1.00
R4587:Kif22 UTSW 7 127032880 critical splice donor site probably null
R4667:Kif22 UTSW 7 127033328 missense probably damaging 1.00
R5082:Kif22 UTSW 7 127033377 missense possibly damaging 0.71
R5853:Kif22 UTSW 7 127033367 missense possibly damaging 0.92
R6045:Kif22 UTSW 7 127031078 missense probably benign 0.00
R6175:Kif22 UTSW 7 127031056 missense possibly damaging 0.53
R6195:Kif22 UTSW 7 127028959 missense probably damaging 0.99
R6407:Kif22 UTSW 7 127033203 missense probably damaging 1.00
R6416:Kif22 UTSW 7 127028932 missense possibly damaging 0.95
R6561:Kif22 UTSW 7 127031053 missense probably benign 0.38
R7122:Kif22 UTSW 7 127032978 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAATCAGAGTGGTCAGCTTC -3'
(R):5'- ACAGCAAGCTCACTCGTCTG -3'

Sequencing Primer
(F):5'- GAATCAGAGTGGTCAGCTTCAGTATC -3'
(R):5'- GCAGGTCATGTCTACCCATG -3'
Posted On2019-10-24