Incidental Mutation 'R7644:Olfr936'
ID590435
Institutional Source Beutler Lab
Gene Symbol Olfr936
Ensembl Gene ENSMUSG00000095194
Gene Nameolfactory receptor 936
SynonymsEG628171, GA_x6K02T2PVTD-32743332-32742397, MOR171-37
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39046614-39047549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39047342 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 26 (D26Y)
Ref Sequence ENSEMBL: ENSMUSP00000137209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178303] [ENSMUST00000216912]
Predicted Effect probably damaging
Transcript: ENSMUST00000178303
AA Change: D26Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137209
Gene: ENSMUSG00000095194
AA Change: D26Y

DomainStartEndE-ValueType
Pfam:7tm_1 1 246 6e-21 PFAM
Pfam:7tm_4 1 264 6.9e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216912
AA Change: *70L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Olfr936
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Olfr936 APN 9 39047413 missense unknown
R0086:Olfr936 UTSW 9 39046895 missense probably benign 0.00
R0561:Olfr936 UTSW 9 39047373 missense probably damaging 0.99
R0650:Olfr936 UTSW 9 39046700 missense probably benign 0.01
R1221:Olfr936 UTSW 9 39047187 missense probably damaging 1.00
R1384:Olfr936 UTSW 9 39046904 missense possibly damaging 0.70
R1680:Olfr936 UTSW 9 39047000 missense probably benign 0.43
R1733:Olfr936 UTSW 9 39047382 missense unknown
R3767:Olfr936 UTSW 9 39047411 missense unknown
R4786:Olfr936 UTSW 9 39047487 nonsense probably null
R4944:Olfr936 UTSW 9 39046862 missense probably damaging 1.00
R5186:Olfr936 UTSW 9 39046969 nonsense probably null
R5403:Olfr936 UTSW 9 39046703 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6037:Olfr936 UTSW 9 39047107 missense probably damaging 1.00
R6156:Olfr936 UTSW 9 39047375 missense possibly damaging 0.90
R6217:Olfr936 UTSW 9 39046743 makesense probably null
R6711:Olfr936 UTSW 9 39046866 makesense probably null
R6919:Olfr936 UTSW 9 39047531 utr 5 prime probably benign
R7022:Olfr936 UTSW 9 39047083 nonsense probably null
R7275:Olfr936 UTSW 9 39047519 utr 5 prime probably benign
R7290:Olfr936 UTSW 9 39047398 missense unknown
Z1176:Olfr936 UTSW 9 39046919
Predicted Primers PCR Primer
(F):5'- GGCACTTATGTTGAGACATGATG -3'
(R):5'- GTGAGCAAATTCTTCCTCTCTGG -3'

Sequencing Primer
(F):5'- GTTGAGACATGATGCTACTGTAAAGC -3'
(R):5'- GGTTTAACAGACCAACCAGAGCTG -3'
Posted On2019-10-24