Incidental Mutation 'R7644:Ephb1'
ID590436
Institutional Source Beutler Lab
Gene Symbol Ephb1
Ensembl Gene ENSMUSG00000032537
Gene NameEph receptor B1
SynonymsCek6, Net, C130099E04Rik, Hek6, Elk, Elkh
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location101922128-102354693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101936194 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 791 (T791A)
Ref Sequence ENSEMBL: ENSMUSP00000035129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169] [ENSMUST00000112841]
Predicted Effect probably damaging
Transcript: ENSMUST00000035129
AA Change: T791A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: T791A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
Pfam:EphA2_TM 542 616 3e-24 PFAM
TyrKc 619 878 6.45e-141 SMART
SAM 908 975 1.22e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000085169
AA Change: T750A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: T750A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
transmembrane domain 541 563 N/A INTRINSIC
TyrKc 585 837 2.35e-134 SMART
SAM 867 934 1.22e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112841
SMART Domains Protein: ENSMUSP00000108460
Gene: ENSMUSG00000057710

DomainStartEndE-ValueType
low complexity region 108 119 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
low complexity region 163 177 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Ephb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Ephb1 APN 9 101996787 missense probably damaging 1.00
IGL01910:Ephb1 APN 9 102001857 missense probably benign 0.00
IGL02006:Ephb1 APN 9 102194772 critical splice donor site probably null
IGL02660:Ephb1 APN 9 102041092 missense possibly damaging 0.94
IGL02685:Ephb1 APN 9 102041103 nonsense probably null
IGL02802:Ephb1 UTSW 9 102010019 missense possibly damaging 0.87
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0180:Ephb1 UTSW 9 101927504 missense probably damaging 0.99
R0488:Ephb1 UTSW 9 101964008 missense probably damaging 1.00
R0511:Ephb1 UTSW 9 101995980 splice site probably benign
R0601:Ephb1 UTSW 9 102195130 missense probably damaging 1.00
R1622:Ephb1 UTSW 9 102001711 missense probably benign 0.00
R1643:Ephb1 UTSW 9 101996825 missense probably damaging 0.99
R1645:Ephb1 UTSW 9 101927559 missense probably damaging 1.00
R1914:Ephb1 UTSW 9 101929378 missense probably damaging 1.00
R1964:Ephb1 UTSW 9 101971123 missense possibly damaging 0.93
R2245:Ephb1 UTSW 9 101996774 splice site probably benign
R2247:Ephb1 UTSW 9 101996811 missense probably damaging 0.98
R2412:Ephb1 UTSW 9 102001816 missense possibly damaging 0.85
R3716:Ephb1 UTSW 9 102194800 missense probably damaging 1.00
R3756:Ephb1 UTSW 9 102041039 missense probably benign 0.01
R3797:Ephb1 UTSW 9 101971267 missense probably damaging 1.00
R3907:Ephb1 UTSW 9 102001726 missense probably benign 0.00
R4981:Ephb1 UTSW 9 102040960 missense probably benign
R5112:Ephb1 UTSW 9 101971179 missense probably damaging 1.00
R5507:Ephb1 UTSW 9 101936116 missense probably damaging 1.00
R5745:Ephb1 UTSW 9 102195434 missense probably benign 0.25
R6082:Ephb1 UTSW 9 101971104 missense probably damaging 1.00
R6183:Ephb1 UTSW 9 102195325 missense probably damaging 1.00
R6228:Ephb1 UTSW 9 101923584 missense probably damaging 1.00
R6572:Ephb1 UTSW 9 102066898 missense probably benign
R6596:Ephb1 UTSW 9 102194802 nonsense probably null
R6813:Ephb1 UTSW 9 102010048 missense possibly damaging 0.87
R6876:Ephb1 UTSW 9 101984120 missense probably damaging 1.00
R6922:Ephb1 UTSW 9 101929264 splice site probably null
R6950:Ephb1 UTSW 9 102194909 missense probably benign 0.03
R7144:Ephb1 UTSW 9 101964077 missense probably damaging 1.00
R7146:Ephb1 UTSW 9 101963958 missense probably damaging 1.00
R7328:Ephb1 UTSW 9 102195239 missense probably damaging 1.00
R7737:Ephb1 UTSW 9 101984103 missense probably damaging 1.00
X0064:Ephb1 UTSW 9 101971272 missense probably damaging 1.00
Z1088:Ephb1 UTSW 9 101984145 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATCACATGGAATGCAGGGC -3'
(R):5'- AGCTCTTCTAAGTAGACTACTGTCAAC -3'

Sequencing Primer
(F):5'- TGCAGGGCATGAGGTATATACACTTG -3'
(R):5'- CAACAGTTATTGCTTGTGGGTC -3'
Posted On2019-10-24