Incidental Mutation 'R7644:Ptprr'
ID 590439
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Name protein tyrosine phosphatase receptor type R
Synonyms PTP-SL, PTPBR7, RPTPRR
MMRRC Submission 045723-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R7644 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 115854118-116110837 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115884133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 63 (H63Q)
Ref Sequence ENSEMBL: ENSMUSP00000064392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470]
AlphaFold Q62132
Predicted Effect probably benign
Transcript: ENSMUST00000063470
AA Change: H63Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: H63Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,687,966 (GRCm39) R209Q possibly damaging Het
Abl2 A G 1: 156,443,563 (GRCm39) D24G probably benign Het
Adar C T 3: 89,652,826 (GRCm39) A754V probably benign Het
Adcy8 C T 15: 64,571,218 (GRCm39) V1172I possibly damaging Het
Adgrl2 C T 3: 148,544,789 (GRCm39) V769M probably damaging Het
Akna T A 4: 63,313,634 (GRCm39) Q163L possibly damaging Het
Alox15 C T 11: 70,236,368 (GRCm39) A511T probably null Het
Ano8 C T 8: 71,937,474 (GRCm39) G90D probably damaging Het
Aqp5 G A 15: 99,492,107 (GRCm39) R235H probably damaging Het
B3galt4 A T 17: 34,169,419 (GRCm39) V273E probably damaging Het
Ccdc125 C T 13: 100,814,884 (GRCm39) probably null Het
Ccdc90b A G 7: 92,216,868 (GRCm39) R47G possibly damaging Het
Celsr2 G T 3: 108,320,806 (GRCm39) L669I probably damaging Het
Clasp1 T G 1: 118,440,480 (GRCm39) probably null Het
Clec4a2 C T 6: 123,101,974 (GRCm39) P43L probably benign Het
Cntn1 T C 15: 92,207,890 (GRCm39) I827T probably benign Het
Col9a1 G T 1: 24,224,243 (GRCm39) V142F unknown Het
Cplane1 T A 15: 8,252,611 (GRCm39) D1944E probably benign Het
Cts7 G T 13: 61,504,782 (GRCm39) Y23* probably null Het
Dcdc2a T A 13: 25,291,674 (GRCm39) Y220N probably damaging Het
Dennd2b A T 7: 109,156,000 (GRCm39) L250* probably null Het
Dmxl1 T G 18: 50,026,619 (GRCm39) V1909G probably benign Het
Ehd2 G A 7: 15,691,474 (GRCm39) P286L possibly damaging Het
Elf3 G T 1: 135,184,244 (GRCm39) A208E possibly damaging Het
Eml5 A G 12: 98,822,203 (GRCm39) I775T probably benign Het
Ephb1 T C 9: 101,813,393 (GRCm39) T791A probably damaging Het
Fanci C A 7: 79,094,219 (GRCm39) S1105* probably null Het
Fastkd1 T A 2: 69,527,184 (GRCm39) probably null Het
Fat4 A G 3: 39,064,390 (GRCm39) E4782G possibly damaging Het
Fnta T C 8: 26,503,516 (GRCm39) I90V probably damaging Het
Fosl1 C T 19: 5,500,332 (GRCm39) R84* probably null Het
Gdf2 T C 14: 33,666,847 (GRCm39) F190L probably benign Het
Gzmn T A 14: 56,404,776 (GRCm39) Q88L probably damaging Het
Hat1 T A 2: 71,240,525 (GRCm39) L73Q probably damaging Het
Hdhd2 G A 18: 77,031,871 (GRCm39) G109E possibly damaging Het
Il22ra1 A G 4: 135,460,346 (GRCm39) N34S probably damaging Het
Ino80d T C 1: 63,097,930 (GRCm39) T760A probably benign Het
Itga7 A G 10: 128,789,370 (GRCm39) D971G probably benign Het
Kdm6b T C 11: 69,291,032 (GRCm39) N1574S unknown Het
Kel T C 6: 41,667,742 (GRCm39) E400G probably benign Het
Kif22 G A 7: 126,632,134 (GRCm39) T350I probably damaging Het
Kif26b A G 1: 178,506,839 (GRCm39) N305S probably benign Het
Klk12 A C 7: 43,419,134 (GRCm39) Q33P probably damaging Het
Klk1b24 G A 7: 43,841,304 (GRCm39) probably null Het
Krtap31-1 T A 11: 99,799,048 (GRCm39) C84S possibly damaging Het
Ky T A 9: 102,414,972 (GRCm39) S295T probably benign Het
Lpin3 T A 2: 160,738,690 (GRCm39) M214K probably benign Het
Mak T A 13: 41,183,586 (GRCm39) N565Y probably benign Het
Mphosph6 T C 8: 118,528,623 (GRCm39) T7A probably benign Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Myh11 T C 16: 14,039,688 (GRCm39) T814A Het
Nmbr T C 10: 14,636,433 (GRCm39) L134P probably damaging Het
Nup107 C T 10: 117,606,375 (GRCm39) V456M probably damaging Het
Or56b1b A G 7: 108,164,649 (GRCm39) S118P possibly damaging Het
Or8g22 C A 9: 38,958,638 (GRCm39) D26Y probably damaging Het
Pink1 A T 4: 138,044,683 (GRCm39) H351Q probably damaging Het
Piwil4 A T 9: 14,645,711 (GRCm39) probably null Het
Pkd1l1 C A 11: 8,825,758 (GRCm39) V1498F Het
Polb A G 8: 23,130,443 (GRCm39) I161T probably benign Het
Polg A T 7: 79,101,416 (GRCm39) L1097Q probably damaging Het
Prelp T C 1: 133,842,356 (GRCm39) N263S probably benign Het
Pten T C 19: 32,789,234 (GRCm39) C211R probably damaging Het
Ptprc G A 1: 137,995,645 (GRCm39) A1012V probably benign Het
Rapsn A T 2: 90,872,299 (GRCm39) H211L possibly damaging Het
Reln T C 5: 22,183,929 (GRCm39) N1690S probably benign Het
Rpap2 A G 5: 107,768,167 (GRCm39) E335G probably benign Het
Rspry1 T A 8: 95,385,396 (GRCm39) S567T probably benign Het
Sf3b1 G A 1: 55,036,302 (GRCm39) R924* probably null Het
Sftpb G A 6: 72,286,818 (GRCm39) E241K probably benign Het
Smarca4 G T 9: 21,566,950 (GRCm39) A677S probably benign Het
Srrm2 G A 17: 24,038,294 (GRCm39) R1646Q unknown Het
Tex15 T A 8: 34,064,445 (GRCm39) C1292S probably benign Het
Tmem140 A G 6: 34,849,708 (GRCm39) I75V probably benign Het
Trhr2 T A 8: 123,084,061 (GRCm39) Q313L possibly damaging Het
Trim35 A G 14: 66,534,546 (GRCm39) T10A unknown Het
Ttn T C 2: 76,750,124 (GRCm39) I3642V probably benign Het
Ugt1a2 T C 1: 88,128,507 (GRCm39) L50P probably damaging Het
Unc13a C A 8: 72,087,182 (GRCm39) V1522L probably benign Het
Usp33 A G 3: 152,063,589 (GRCm39) D21G possibly damaging Het
Vmn1r90 G A 7: 14,295,616 (GRCm39) Q161* probably null Het
Vmn2r117 A T 17: 23,696,265 (GRCm39) W381R probably damaging Het
Vmn2r16 G C 5: 109,487,837 (GRCm39) A237P probably damaging Het
Vmn2r74 A G 7: 85,606,746 (GRCm39) V200A probably benign Het
Yjefn3 C T 8: 70,340,544 (GRCm39) V227M probably damaging Het
Zfp652 T C 11: 95,640,914 (GRCm39) F280L probably damaging Het
Zfp748 G A 13: 67,689,568 (GRCm39) T564I probably damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116,024,222 (GRCm39) missense probably benign 0.00
IGL01762:Ptprr APN 10 116,072,638 (GRCm39) missense probably damaging 1.00
IGL02429:Ptprr APN 10 116,109,672 (GRCm39) missense probably damaging 0.99
IGL03396:Ptprr APN 10 116,024,235 (GRCm39) missense probably damaging 1.00
R0268:Ptprr UTSW 10 116,088,868 (GRCm39) missense possibly damaging 0.83
R0584:Ptprr UTSW 10 116,087,063 (GRCm39) missense probably damaging 0.96
R1388:Ptprr UTSW 10 116,109,657 (GRCm39) missense probably benign 0.14
R1438:Ptprr UTSW 10 116,092,109 (GRCm39) missense probably damaging 0.98
R1533:Ptprr UTSW 10 116,024,113 (GRCm39) nonsense probably null
R1654:Ptprr UTSW 10 116,024,268 (GRCm39) missense probably benign 0.43
R1793:Ptprr UTSW 10 116,088,827 (GRCm39) missense probably damaging 1.00
R4081:Ptprr UTSW 10 116,072,615 (GRCm39) missense probably benign 0.01
R4193:Ptprr UTSW 10 116,088,769 (GRCm39) missense probably damaging 1.00
R4254:Ptprr UTSW 10 115,998,348 (GRCm39) splice site probably null
R4496:Ptprr UTSW 10 116,065,407 (GRCm39) missense possibly damaging 0.91
R4799:Ptprr UTSW 10 115,884,123 (GRCm39) missense probably benign 0.00
R5209:Ptprr UTSW 10 115,998,514 (GRCm39) missense probably damaging 0.99
R5312:Ptprr UTSW 10 116,024,324 (GRCm39) missense probably benign 0.28
R5410:Ptprr UTSW 10 116,024,235 (GRCm39) missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116,087,054 (GRCm39) missense probably damaging 0.96
R5717:Ptprr UTSW 10 115,884,018 (GRCm39) missense probably benign 0.11
R6039:Ptprr UTSW 10 116,072,668 (GRCm39) splice site probably null
R6039:Ptprr UTSW 10 116,072,668 (GRCm39) splice site probably null
R7013:Ptprr UTSW 10 116,072,659 (GRCm39) missense probably damaging 1.00
R7401:Ptprr UTSW 10 115,884,141 (GRCm39) missense probably benign
R7527:Ptprr UTSW 10 116,087,104 (GRCm39) missense probably benign 0.08
R7651:Ptprr UTSW 10 116,087,084 (GRCm39) missense probably benign 0.01
R7708:Ptprr UTSW 10 115,998,502 (GRCm39) missense probably benign 0.31
R7731:Ptprr UTSW 10 116,073,200 (GRCm39) missense probably damaging 1.00
R8026:Ptprr UTSW 10 115,884,075 (GRCm39) missense probably damaging 1.00
R8261:Ptprr UTSW 10 116,073,169 (GRCm39) missense possibly damaging 0.95
R8358:Ptprr UTSW 10 115,884,180 (GRCm39) missense probably benign 0.25
R8387:Ptprr UTSW 10 116,087,030 (GRCm39) missense probably damaging 1.00
R8894:Ptprr UTSW 10 115,884,250 (GRCm39) missense probably benign 0.00
R9142:Ptprr UTSW 10 116,024,119 (GRCm39) missense possibly damaging 0.90
R9375:Ptprr UTSW 10 116,109,724 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTAGCAGAAGATGGCCTAGTAC -3'
(R):5'- GGTACTTACCACCACAATCACATTTG -3'

Sequencing Primer
(F):5'- GGCCTAGTACACAAAAATATACATGC -3'
(R):5'- ACAATCACATTTGCTGCTGG -3'
Posted On 2019-10-24