Incidental Mutation 'R7644:Itga7'
ID590441
Institutional Source Beutler Lab
Gene Symbol Itga7
Ensembl Gene ENSMUSG00000025348
Gene Nameintegrin alpha 7
Synonyms[a]7, alpha7
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128933818-128958282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128953501 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 971 (D971G)
Ref Sequence ENSEMBL: ENSMUSP00000151960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026398] [ENSMUST00000099112] [ENSMUST00000218290]
Predicted Effect probably benign
Transcript: ENSMUST00000026398
SMART Domains Protein: ENSMUSP00000026398
Gene: ENSMUSG00000025347

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ubie_methyltran 40 193 2.8e-9 PFAM
Pfam:Methyltransf_23 43 222 5.5e-20 PFAM
Pfam:Methyltransf_31 68 225 1.6e-15 PFAM
Pfam:Methyltransf_18 71 175 4.6e-10 PFAM
Pfam:Methyltransf_25 74 168 2.3e-10 PFAM
Pfam:Methyltransf_12 75 170 8.8e-16 PFAM
Pfam:Methyltransf_11 75 172 1.9e-22 PFAM
Pfam:Methyltransf_8 120 192 3.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099112
AA Change: D967G

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096712
Gene: ENSMUSG00000025348
AA Change: D967G

DomainStartEndE-ValueType
Int_alpha 48 110 4.11e-6 SMART
Int_alpha 259 312 3.72e-4 SMART
Int_alpha 316 372 1.16e-14 SMART
Int_alpha 377 430 9.21e-18 SMART
Int_alpha 435 490 4.38e-1 SMART
low complexity region 510 523 N/A INTRINSIC
SCOP:d1m1xa3 807 1039 6e-50 SMART
low complexity region 1041 1058 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218290
AA Change: D971G

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219897
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded transmembrane protein is the alpha subunit that forms a noncovalent heterodimer with the beta subunit to form the functional integrin receptor that binds to laminin. Mice lacking the encoded protein exhibit symptoms of progressive muscular dystrophy, impaired axonal regeneration and cerebral vascular defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene display characteristics of muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Itga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Itga7 APN 10 128941854 missense possibly damaging 0.67
IGL00809:Itga7 APN 10 128939169 critical splice donor site probably null
IGL01448:Itga7 APN 10 128949468 nonsense probably null
IGL01675:Itga7 APN 10 128946855 missense probably damaging 1.00
IGL02158:Itga7 APN 10 128953782 missense possibly damaging 0.95
IGL02475:Itga7 APN 10 128934089 missense probably damaging 1.00
IGL02689:Itga7 APN 10 128946818 missense possibly damaging 0.83
IGL02946:Itga7 APN 10 128934083 missense probably benign
IGL03223:Itga7 APN 10 128948811 unclassified probably benign
R0662:Itga7 UTSW 10 128953531 missense probably damaging 1.00
R0972:Itga7 UTSW 10 128942877 missense probably damaging 0.98
R1449:Itga7 UTSW 10 128953501 missense probably benign 0.13
R1521:Itga7 UTSW 10 128957811 missense possibly damaging 0.63
R1597:Itga7 UTSW 10 128946863 missense probably benign 0.17
R1651:Itga7 UTSW 10 128948824 missense probably benign 0.01
R4718:Itga7 UTSW 10 128940734 frame shift probably null
R5011:Itga7 UTSW 10 128949447 missense possibly damaging 0.51
R5151:Itga7 UTSW 10 128944511 missense possibly damaging 0.91
R5287:Itga7 UTSW 10 128943158 missense probably benign 0.38
R5419:Itga7 UTSW 10 128944033 missense probably null 0.06
R5907:Itga7 UTSW 10 128942981 missense probably damaging 1.00
R6165:Itga7 UTSW 10 128942935 missense probably benign 0.16
R6189:Itga7 UTSW 10 128950403 missense possibly damaging 0.76
R6263:Itga7 UTSW 10 128944086 missense probably benign
R6612:Itga7 UTSW 10 128948993 missense possibly damaging 0.65
R6746:Itga7 UTSW 10 128949472 missense probably benign 0.13
R6850:Itga7 UTSW 10 128945516 missense probably damaging 1.00
R7226:Itga7 UTSW 10 128940932 missense probably damaging 0.98
R7257:Itga7 UTSW 10 128944413 missense possibly damaging 0.55
R7344:Itga7 UTSW 10 128940929 missense possibly damaging 0.63
R7456:Itga7 UTSW 10 128941936 missense probably damaging 1.00
R7545:Itga7 UTSW 10 128933906 start gained probably benign
R7643:Itga7 UTSW 10 128953501 missense probably benign 0.13
R7822:Itga7 UTSW 10 128942966 missense probably benign 0.00
R7949:Itga7 UTSW 10 128941252 intron probably null
R7998:Itga7 UTSW 10 128934151 missense not run
X0020:Itga7 UTSW 10 128942877 missense probably damaging 0.98
Z1088:Itga7 UTSW 10 128949163 missense probably benign 0.10
Z1176:Itga7 UTSW 10 128953827 missense not run
Z1177:Itga7 UTSW 10 128943214 missense not run
Predicted Primers PCR Primer
(F):5'- CCCTCCAATGTGTTTCAAAGCC -3'
(R):5'- GCAGAGGGTAAACGTGTCTTTAC -3'

Sequencing Primer
(F):5'- GCACTATTTAGGGCCAGAGG -3'
(R):5'- GTAAACGTGTCTTTACAGAGTGC -3'
Posted On2019-10-24