Incidental Mutation 'R7644:2410089E03Rik'
ID590455
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8223127 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1944 (D1944E)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617] [ENSMUST00000228039]
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: D1944E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: D1944E

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228039
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7919:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7958:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7984:2410089E03Rik UTSW 15 8269706 missense unknown
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGGTCATTTTGTCACTTGCT -3'
(R):5'- GCATTTATCAAGAACAATTCACTGTC -3'

Sequencing Primer
(F):5'- GTCACTTGCTTTTTAGACCGG -3'
(R):5'- TTGAGGTTTCAAAAGCCCATGGC -3'
Posted On2019-10-24