Mutagenetix > Incidental Mutation

Incidental Mutation 'R7644:Vmn2r117'

590460

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R7644 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23477291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 381 (W381R)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: W381R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: W381R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

100% (86/86)

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001O22Rik	C	T	2: 30,797,954	R209Q	possibly damaging	Het
2410089E03Rik	T	A	15: 8,223,127	D1944E	probably benign	Het
Abl2	A	G	1: 156,615,993	D24G	probably benign	Het
Adar	C	T	3: 89,745,519	A754V	probably benign	Het
Adcy8	C	T	15: 64,699,369	V1172I	possibly damaging	Het
Adgrl2	C	T	3: 148,839,153	V769M	probably damaging	Het
Akna	T	A	4: 63,395,397	Q163L	possibly damaging	Het
Alox15	C	T	11: 70,345,542	A511T	probably null	Het
Ano8	C	T	8: 71,484,830	G90D	probably damaging	Het
Aqp5	G	A	15: 99,594,226	R235H	probably damaging	Het
B3galt4	A	T	17: 33,950,445	V273E	probably damaging	Het
Ccdc125	C	T	13: 100,678,376		probably null	Het
Ccdc90b	A	G	7: 92,567,660	R47G	possibly damaging	Het
Celsr2	G	T	3: 108,413,490	L669I	probably damaging	Het
Clasp1	T	G	1: 118,512,750		probably null	Het
Clec4a2	C	T	6: 123,125,015	P43L	probably benign	Het
Cntn1	T	C	15: 92,310,009	I827T	probably benign	Het
Col9a1	G	T	1: 24,185,162	V142F	unknown	Het
Cts7	G	T	13: 61,356,968	Y23*	probably null	Het
Dcdc2a	T	A	13: 25,107,691	Y220N	probably damaging	Het
Dmxl1	T	G	18: 49,893,552	V1909G	probably benign	Het
Ehd2	G	A	7: 15,957,549	P286L	possibly damaging	Het
Elf3	G	T	1: 135,256,506	A208E	possibly damaging	Het
Eml5	A	G	12: 98,855,944	I775T	probably benign	Het
Ephb1	T	C	9: 101,936,194	T791A	probably damaging	Het
Fanci	C	A	7: 79,444,471	S1105*	probably null	Het
Fastkd1	T	A	2: 69,696,840		probably null	Het
Fat4	A	G	3: 39,010,241	E4782G	possibly damaging	Het
Fnta	T	C	8: 26,013,488	I90V	probably damaging	Het
Fosl1	C	T	19: 5,450,304	R84*	probably null	Het
Gdf2	T	C	14: 33,944,890	F190L	probably benign	Het
Gzmn	T	A	14: 56,167,319	Q88L	probably damaging	Het
Hat1	T	A	2: 71,410,181	L73Q	probably damaging	Het
Hdhd2	G	A	18: 76,944,175	G109E	possibly damaging	Het
Il22ra1	A	G	4: 135,733,035	N34S	probably damaging	Het
Ino80d	T	C	1: 63,058,771	T760A	probably benign	Het
Itga7	A	G	10: 128,953,501	D971G	probably benign	Het
Kdm6b	T	C	11: 69,400,206	N1574S	unknown	Het
Kel	T	C	6: 41,690,808	E400G	probably benign	Het
Kif22	G	A	7: 127,032,962	T350I	probably damaging	Het
Kif26b	A	G	1: 178,679,274	N305S	probably benign	Het
Klk12	A	C	7: 43,769,710	Q33P	probably damaging	Het
Klk1b24	G	A	7: 44,191,880		probably null	Het
Krtap31-1	T	A	11: 99,908,222	C84S	possibly damaging	Het
Ky	T	A	9: 102,537,773	S295T	probably benign	Het
Lpin3	T	A	2: 160,896,770	M214K	probably benign	Het
Mak	T	A	13: 41,030,110	N565Y	probably benign	Het
Mphosph6	T	C	8: 117,801,884	T7A	probably benign	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Myh11	T	C	16: 14,221,824	T814A		Het
Nmbr	T	C	10: 14,760,689	L134P	probably damaging	Het
Nup107	C	T	10: 117,770,470	V456M	probably damaging	Het
Olfr504	A	G	7: 108,565,442	S118P	possibly damaging	Het
Olfr936	C	A	9: 39,047,342	D26Y	probably damaging	Het
Pink1	A	T	4: 138,317,372	H351Q	probably damaging	Het
Piwil4	A	T	9: 14,734,415		probably null	Het
Pkd1l1	C	A	11: 8,875,758	V1498F		Het
Polb	A	G	8: 22,640,427	I161T	probably benign	Het
Polg	A	T	7: 79,451,668	L1097Q	probably damaging	Het
Prelp	T	C	1: 133,914,618	N263S	probably benign	Het
Pten	T	C	19: 32,811,834	C211R	probably damaging	Het
Ptprc	G	A	1: 138,067,907	A1012V	probably benign	Het
Ptprr	T	A	10: 116,048,228	H63Q	probably benign	Het
Rapsn	A	T	2: 91,041,954	H211L	possibly damaging	Het
Reln	T	C	5: 21,978,931	N1690S	probably benign	Het
Rpap2	A	G	5: 107,620,301	E335G	probably benign	Het
Rspry1	T	A	8: 94,658,768	S567T	probably benign	Het
Sf3b1	G	A	1: 54,997,143	R924*	probably null	Het
Sftpb	G	A	6: 72,309,835	E241K	probably benign	Het
Smarca4	G	T	9: 21,655,654	A677S	probably benign	Het
Srrm2	G	A	17: 23,819,320	R1646Q	unknown	Het
St5	A	T	7: 109,556,793	L250*	probably null	Het
Tex15	T	A	8: 33,574,417	C1292S	probably benign	Het
Tmem140	A	G	6: 34,872,773	I75V	probably benign	Het
Trhr2	T	A	8: 122,357,322	Q313L	possibly damaging	Het
Trim35	A	G	14: 66,297,097	T10A	unknown	Het
Ttn	T	C	2: 76,919,780	I3642V	probably benign	Het
Ugt1a2	T	C	1: 88,200,785	L50P	probably damaging	Het
Unc13a	C	A	8: 71,634,538	V1522L	probably benign	Het
Usp33	A	G	3: 152,357,952	D21G	possibly damaging	Het
Vmn1r90	G	A	7: 14,561,691	Q161*	probably null	Het
Vmn2r16	G	C	5: 109,339,971	A237P	probably damaging	Het
Vmn2r74	A	G	7: 85,957,538	V200A	probably benign	Het
Yjefn3	C	T	8: 69,887,894	V227M	probably damaging	Het
Zfp652	T	C	11: 95,750,088	F280L	probably damaging	Het
Zfp748	G	A	13: 67,541,449	T564I	probably damaging	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R6913:Vmn2r117	UTSW	17	23479563	missense	probably damaging	0.99
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAAACATTACCTTCTTGCAGC -3'
(R):5'- GGATGTCAGTCCTAGTATGAAAGAC -3'

Sequencing Primer
(F):5'- ACCTTCTTGCAGCTATAATTGTG -3'
(R):5'- GGACTTTTGCTTTTGGACAACAC -3'

Posted On

2019-10-24