Incidental Mutation 'R7644:Srrm2'
ID590461
Institutional Source Beutler Lab
Gene Symbol Srrm2
Ensembl Gene ENSMUSG00000039218
Gene Nameserine/arginine repetitive matrix 2
Synonyms5033413A03Rik, SRm300
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23790662-23824741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23819320 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1646 (R1646Q)
Ref Sequence ENSEMBL: ENSMUSP00000085993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088621] [ENSMUST00000190686]
Predicted Effect unknown
Transcript: ENSMUST00000088621
AA Change: R1646Q
SMART Domains Protein: ENSMUSP00000085993
Gene: ENSMUSG00000039218
AA Change: R1646Q

DomainStartEndE-ValueType
low complexity region 82 157 N/A INTRINSIC
low complexity region 161 188 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
internal_repeat_4 248 305 2.93e-5 PROSPERO
internal_repeat_5 259 388 2.93e-5 PROSPERO
low complexity region 407 423 N/A INTRINSIC
CTD 464 584 5.25e-14 SMART
low complexity region 652 682 N/A INTRINSIC
low complexity region 689 721 N/A INTRINSIC
internal_repeat_6 732 778 4.88e-5 PROSPERO
low complexity region 779 795 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
internal_repeat_2 859 1124 6.34e-6 PROSPERO
internal_repeat_1 1055 1183 3.81e-6 PROSPERO
internal_repeat_4 1113 1166 2.93e-5 PROSPERO
internal_repeat_6 1169 1213 4.88e-5 PROSPERO
low complexity region 1236 1244 N/A INTRINSIC
low complexity region 1275 1286 N/A INTRINSIC
low complexity region 1290 1312 N/A INTRINSIC
internal_repeat_2 1313 1485 6.34e-6 PROSPERO
low complexity region 1493 1525 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
low complexity region 1559 1720 N/A INTRINSIC
low complexity region 1734 1919 N/A INTRINSIC
low complexity region 1926 1951 N/A INTRINSIC
low complexity region 1966 1980 N/A INTRINSIC
low complexity region 2079 2105 N/A INTRINSIC
internal_repeat_3 2107 2118 1.06e-5 PROSPERO
internal_repeat_3 2135 2146 1.06e-5 PROSPERO
low complexity region 2153 2172 N/A INTRINSIC
internal_repeat_5 2182 2320 2.93e-5 PROSPERO
internal_repeat_1 2224 2368 3.81e-6 PROSPERO
low complexity region 2390 2425 N/A INTRINSIC
low complexity region 2518 2539 N/A INTRINSIC
low complexity region 2541 2550 N/A INTRINSIC
low complexity region 2552 2571 N/A INTRINSIC
low complexity region 2594 2607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186259
Predicted Effect unknown
Transcript: ENSMUST00000190686
AA Change: R1742Q
SMART Domains Protein: ENSMUSP00000139842
Gene: ENSMUSG00000039218
AA Change: R1742Q

DomainStartEndE-ValueType
Pfam:cwf21 58 102 1.5e-13 PFAM
low complexity region 178 253 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
low complexity region 319 334 N/A INTRINSIC
internal_repeat_4 344 401 3.07e-5 PROSPERO
internal_repeat_5 355 484 3.07e-5 PROSPERO
low complexity region 503 519 N/A INTRINSIC
CTD 560 680 5.25e-14 SMART
low complexity region 748 778 N/A INTRINSIC
low complexity region 785 817 N/A INTRINSIC
internal_repeat_6 828 874 5.11e-5 PROSPERO
low complexity region 875 891 N/A INTRINSIC
low complexity region 898 920 N/A INTRINSIC
low complexity region 935 949 N/A INTRINSIC
internal_repeat_2 955 1220 6.62e-6 PROSPERO
internal_repeat_1 1151 1279 3.97e-6 PROSPERO
internal_repeat_4 1209 1262 3.07e-5 PROSPERO
internal_repeat_6 1265 1309 5.11e-5 PROSPERO
low complexity region 1332 1340 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
low complexity region 1386 1408 N/A INTRINSIC
internal_repeat_2 1409 1581 6.62e-6 PROSPERO
low complexity region 1589 1621 N/A INTRINSIC
low complexity region 1641 1651 N/A INTRINSIC
low complexity region 1655 1816 N/A INTRINSIC
low complexity region 1830 2015 N/A INTRINSIC
low complexity region 2022 2047 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
low complexity region 2175 2201 N/A INTRINSIC
internal_repeat_3 2203 2214 1.1e-5 PROSPERO
internal_repeat_3 2231 2242 1.1e-5 PROSPERO
low complexity region 2249 2268 N/A INTRINSIC
internal_repeat_5 2278 2416 3.07e-5 PROSPERO
internal_repeat_1 2320 2464 3.97e-6 PROSPERO
low complexity region 2486 2521 N/A INTRINSIC
low complexity region 2614 2635 N/A INTRINSIC
low complexity region 2637 2646 N/A INTRINSIC
low complexity region 2648 2667 N/A INTRINSIC
low complexity region 2690 2703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Fosl1 C T 19: 5,450,304 R84* probably null Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Srrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Srrm2 APN 17 23812478 missense probably benign 0.23
IGL00484:Srrm2 APN 17 23818518 missense probably benign 0.23
IGL01413:Srrm2 APN 17 23816025 unclassified probably benign
IGL02272:Srrm2 APN 17 23815782 unclassified probably benign
IGL02279:Srrm2 APN 17 23815332 unclassified probably benign
IGL02325:Srrm2 APN 17 23810479 unclassified probably benign
IGL02947:Srrm2 APN 17 23810746 missense probably benign 0.23
IGL03002:Srrm2 APN 17 23815734 unclassified probably benign
R0173:Srrm2 UTSW 17 23815129 unclassified probably benign
R1018:Srrm2 UTSW 17 23822540 missense probably damaging 0.98
R1109:Srrm2 UTSW 17 23819617 unclassified probably benign
R1199:Srrm2 UTSW 17 23817751 unclassified probably benign
R1471:Srrm2 UTSW 17 23820796 missense probably damaging 1.00
R1478:Srrm2 UTSW 17 23815902 missense probably benign 0.23
R1618:Srrm2 UTSW 17 23818932 unclassified probably benign
R1678:Srrm2 UTSW 17 23818986 missense probably benign 0.23
R1853:Srrm2 UTSW 17 23820525 missense probably damaging 1.00
R1968:Srrm2 UTSW 17 23821491 missense probably damaging 1.00
R2094:Srrm2 UTSW 17 23812429 unclassified probably benign
R2102:Srrm2 UTSW 17 23817748 unclassified probably benign
R2156:Srrm2 UTSW 17 23818263 missense probably benign 0.23
R2214:Srrm2 UTSW 17 23816745 unclassified probably benign
R2913:Srrm2 UTSW 17 23815684 unclassified probably benign
R3721:Srrm2 UTSW 17 23822575 small deletion probably benign
R4411:Srrm2 UTSW 17 23810468 unclassified probably benign
R4412:Srrm2 UTSW 17 23810468 unclassified probably benign
R4413:Srrm2 UTSW 17 23810468 unclassified probably benign
R4583:Srrm2 UTSW 17 23819619 unclassified probably benign
R4682:Srrm2 UTSW 17 23815692 missense probably benign 0.23
R4910:Srrm2 UTSW 17 23815388 unclassified probably benign
R4943:Srrm2 UTSW 17 23822415 missense possibly damaging 0.94
R5023:Srrm2 UTSW 17 23819317 unclassified probably benign
R5033:Srrm2 UTSW 17 23820618 missense probably damaging 1.00
R5163:Srrm2 UTSW 17 23819550 unclassified probably benign
R5186:Srrm2 UTSW 17 23816587 missense probably benign 0.23
R5197:Srrm2 UTSW 17 23817384 missense probably benign 0.23
R5366:Srrm2 UTSW 17 23818704 missense probably benign 0.23
R5483:Srrm2 UTSW 17 23821272 missense probably damaging 0.96
R5551:Srrm2 UTSW 17 23818476 unclassified probably benign
R5602:Srrm2 UTSW 17 23819337 unclassified probably benign
R5733:Srrm2 UTSW 17 23821386 missense probably damaging 0.98
R5774:Srrm2 UTSW 17 23818275 unclassified probably benign
R5909:Srrm2 UTSW 17 23821317 missense probably benign 0.27
R5961:Srrm2 UTSW 17 23820109 unclassified probably benign
R6122:Srrm2 UTSW 17 23820356 missense possibly damaging 0.58
R6906:Srrm2 UTSW 17 23820363 missense probably damaging 0.97
R7084:Srrm2 UTSW 17 23820316 missense probably damaging 0.99
R7177:Srrm2 UTSW 17 23816773 missense unknown
R7197:Srrm2 UTSW 17 23818224 missense unknown
R7442:Srrm2 UTSW 17 23820117 missense unknown
R7664:Srrm2 UTSW 17 23820981 missense probably damaging 0.99
R7874:Srrm2 UTSW 17 23815678 missense unknown
R7957:Srrm2 UTSW 17 23815678 missense unknown
RF006:Srrm2 UTSW 17 23812588 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGTATCTTCACCAGAGCC -3'
(R):5'- CCAAGGAGCTGGTGATGTTC -3'

Sequencing Primer
(F):5'- GAGCCAACTGAAAAGTCAAGGTCTTC -3'
(R):5'- TCGCTTCCGACTGGTCAAG -3'
Posted On2019-10-24