Incidental Mutation 'R7644:Fosl1'
ID590464
Institutional Source Beutler Lab
Gene Symbol Fosl1
Ensembl Gene ENSMUSG00000024912
Gene Namefos-like antigen 1
SynonymsFra1, fra-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7644 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5447703-5455945 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 5450304 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 84 (R84*)
Ref Sequence ENSEMBL: ENSMUSP00000025850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025850]
Predicted Effect probably null
Transcript: ENSMUST00000025850
AA Change: R84*
SMART Domains Protein: ENSMUSP00000025850
Gene: ENSMUSG00000024912
AA Change: R84*

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 21 35 N/A INTRINSIC
BRLZ 103 167 3.43e-13 SMART
low complexity region 182 200 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 247 271 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to in utero lethality. Embryos homozygous for a reporter/null allele are severely growth retarded and display defects in the extra-embryonic compartment, including a highly abnormal yolk sac and a narrow, largely avascular placental labyrinth layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik C T 2: 30,797,954 R209Q possibly damaging Het
2410089E03Rik T A 15: 8,223,127 D1944E probably benign Het
Abl2 A G 1: 156,615,993 D24G probably benign Het
Adar C T 3: 89,745,519 A754V probably benign Het
Adcy8 C T 15: 64,699,369 V1172I possibly damaging Het
Adgrl2 C T 3: 148,839,153 V769M probably damaging Het
Akna T A 4: 63,395,397 Q163L possibly damaging Het
Alox15 C T 11: 70,345,542 A511T probably null Het
Ano8 C T 8: 71,484,830 G90D probably damaging Het
Aqp5 G A 15: 99,594,226 R235H probably damaging Het
B3galt4 A T 17: 33,950,445 V273E probably damaging Het
Ccdc90b A G 7: 92,567,660 R47G possibly damaging Het
Celsr2 G T 3: 108,413,490 L669I probably damaging Het
Clec4a2 C T 6: 123,125,015 P43L probably benign Het
Cntn1 T C 15: 92,310,009 I827T probably benign Het
Col9a1 G T 1: 24,185,162 V142F unknown Het
Cts7 G T 13: 61,356,968 Y23* probably null Het
Dcdc2a T A 13: 25,107,691 Y220N probably damaging Het
Dmxl1 T G 18: 49,893,552 V1909G probably benign Het
Ehd2 G A 7: 15,957,549 P286L possibly damaging Het
Elf3 G T 1: 135,256,506 A208E possibly damaging Het
Eml5 A G 12: 98,855,944 I775T probably benign Het
Ephb1 T C 9: 101,936,194 T791A probably damaging Het
Fanci C A 7: 79,444,471 S1105* probably null Het
Fat4 A G 3: 39,010,241 E4782G possibly damaging Het
Fnta T C 8: 26,013,488 I90V probably damaging Het
Gdf2 T C 14: 33,944,890 F190L probably benign Het
Gzmn T A 14: 56,167,319 Q88L probably damaging Het
Hat1 T A 2: 71,410,181 L73Q probably damaging Het
Il22ra1 A G 4: 135,733,035 N34S probably damaging Het
Ino80d T C 1: 63,058,771 T760A probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Kdm6b T C 11: 69,400,206 N1574S unknown Het
Kel T C 6: 41,690,808 E400G probably benign Het
Kif22 G A 7: 127,032,962 T350I probably damaging Het
Kif26b A G 1: 178,679,274 N305S probably benign Het
Klk12 A C 7: 43,769,710 Q33P probably damaging Het
Krtap31-1 T A 11: 99,908,222 C84S possibly damaging Het
Ky T A 9: 102,537,773 S295T probably benign Het
Lpin3 T A 2: 160,896,770 M214K probably benign Het
Mak T A 13: 41,030,110 N565Y probably benign Het
Mphosph6 T C 8: 117,801,884 T7A probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh11 T C 16: 14,221,824 T814A Het
Nmbr T C 10: 14,760,689 L134P probably damaging Het
Nup107 C T 10: 117,770,470 V456M probably damaging Het
Olfr504 A G 7: 108,565,442 S118P possibly damaging Het
Olfr936 C A 9: 39,047,342 D26Y probably damaging Het
Pink1 A T 4: 138,317,372 H351Q probably damaging Het
Pkd1l1 C A 11: 8,875,758 V1498F Het
Polb A G 8: 22,640,427 I161T probably benign Het
Polg A T 7: 79,451,668 L1097Q probably damaging Het
Prelp T C 1: 133,914,618 N263S probably benign Het
Pten T C 19: 32,811,834 C211R probably damaging Het
Ptprc G A 1: 138,067,907 A1012V probably benign Het
Ptprr T A 10: 116,048,228 H63Q probably benign Het
Rapsn A T 2: 91,041,954 H211L possibly damaging Het
Reln T C 5: 21,978,931 N1690S probably benign Het
Rpap2 A G 5: 107,620,301 E335G probably benign Het
Rspry1 T A 8: 94,658,768 S567T probably benign Het
Sf3b1 G A 1: 54,997,143 R924* probably null Het
Sftpb G A 6: 72,309,835 E241K probably benign Het
Smarca4 G T 9: 21,655,654 A677S probably benign Het
Srrm2 G A 17: 23,819,320 R1646Q unknown Het
St5 A T 7: 109,556,793 L250* probably null Het
Tex15 T A 8: 33,574,417 C1292S probably benign Het
Tmem140 A G 6: 34,872,773 I75V probably benign Het
Trhr2 T A 8: 122,357,322 Q313L possibly damaging Het
Trim35 A G 14: 66,297,097 T10A unknown Het
Ttn T C 2: 76,919,780 I3642V probably benign Het
Ugt1a2 T C 1: 88,200,785 L50P probably damaging Het
Unc13a C A 8: 71,634,538 V1522L probably benign Het
Usp33 A G 3: 152,357,952 D21G possibly damaging Het
Vmn1r90 G A 7: 14,561,691 Q161* probably null Het
Vmn2r117 A T 17: 23,477,291 W381R probably damaging Het
Vmn2r16 G C 5: 109,339,971 A237P probably damaging Het
Vmn2r74 A G 7: 85,957,538 V200A probably benign Het
Yjefn3 C T 8: 69,887,894 V227M probably damaging Het
Zfp652 T C 11: 95,750,088 F280L probably damaging Het
Zfp748 G A 13: 67,541,449 T564I probably damaging Het
Other mutations in Fosl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Fosl1 APN 19 5450302 missense probably damaging 1.00
R1782:Fosl1 UTSW 19 5450182 missense probably damaging 0.97
R2000:Fosl1 UTSW 19 5450355 splice site probably benign
R5582:Fosl1 UTSW 19 5455267 unclassified probably benign
R5610:Fosl1 UTSW 19 5455105 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACAGAAGTCCAGCCTCTGTC -3'
(R):5'- AGACAGTGGAGACATGCTCAC -3'

Sequencing Primer
(F):5'- AGTCCACACAGACCTTATCATTTC -3'
(R):5'- GAAGCCTTCCTTGACTCAAAGGTG -3'
Posted On2019-10-24