Incidental Mutation 'R7645:Olfr1265'
List |< first << previous [record 26 of 48] next >> last >|
ID590468
Institutional Source Beutler Lab
Gene Symbol Olfr1265
Ensembl Gene ENSMUSG00000059910
Gene Nameolfactory receptor 1265
SynonymsGA_x6K02T2Q125-51469027-51469956, MOR228-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90035337-90042214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90037747 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 276 (I276K)
Ref Sequence ENSEMBL: ENSMUSP00000149684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080311] [ENSMUST00000214855]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080311
AA Change: I276K

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079190
Gene: ENSMUSG00000059910
AA Change: I276K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.9e-49 PFAM
Pfam:7tm_1 39 285 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214855
AA Change: I276K

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Olfr1265
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Olfr1265 APN 2 90037468 missense probably damaging 1.00
IGL01470:Olfr1265 APN 2 90037818 missense possibly damaging 0.81
IGL01878:Olfr1265 APN 2 90037134 missense probably damaging 0.97
IGL02716:Olfr1265 APN 2 90037794 missense probably benign 0.05
IGL03066:Olfr1265 APN 2 90037434 missense probably damaging 0.99
R1310:Olfr1265 UTSW 2 90037703 missense probably benign 0.02
R4986:Olfr1265 UTSW 2 90037428 missense probably damaging 1.00
R5101:Olfr1265 UTSW 2 90037047 missense probably benign 0.00
R6149:Olfr1265 UTSW 2 90037516 missense probably benign 0.01
R6400:Olfr1265 UTSW 2 90037395 missense probably benign 0.00
R7367:Olfr1265 UTSW 2 90037812 missense probably benign 0.02
R7432:Olfr1265 UTSW 2 90037184 missense probably damaging 0.99
R7849:Olfr1265 UTSW 2 90037282 missense probably damaging 1.00
X0019:Olfr1265 UTSW 2 90037644 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAACTCTGTCAGTGATCAGC -3'
(R):5'- AGCAGTCCTTTCCCTCAGTG -3'

Sequencing Primer
(F):5'- AGCATCCTATGTGGTCATCTTG -3'
(R):5'- AGTGCCCATCAGTTTGGACTCAG -3'
Posted On2019-10-24