Incidental Mutation 'R7645:Tyro3'
ID590469
Institutional Source Beutler Lab
Gene Symbol Tyro3
Ensembl Gene ENSMUSG00000027298
Gene NameTYRO3 protein tyrosine kinase 3
SynonymsBrt, Etk-2, Sky, Sky, Dtk, Rse, Tif
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119797733-119818104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119816906 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 839 (Y839H)
Ref Sequence ENSEMBL: ENSMUSP00000028763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028763] [ENSMUST00000110783]
PDB Structure
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Inhibitor bound structure of the kinase domain of the murine receptor tyrosine kinase TYRO3 (Sky) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028763
AA Change: Y839H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028763
Gene: ENSMUSG00000027298
AA Change: Y839H

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IGc2 45 114 1.29e-15 SMART
IG 135 212 1.3e-2 SMART
FN3 215 297 1.5e-5 SMART
FN3 313 393 1.9e0 SMART
transmembrane domain 419 441 N/A INTRINSIC
TyrKc 508 776 1.18e-125 SMART
low complexity region 817 832 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110783
AA Change: Y835H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106410
Gene: ENSMUSG00000027298
AA Change: Y835H

DomainStartEndE-ValueType
IGc2 41 110 1.29e-15 SMART
IG 131 208 1.3e-2 SMART
FN3 211 293 1.5e-5 SMART
FN3 309 389 1.9e0 SMART
transmembrane domain 415 437 N/A INTRINSIC
TyrKc 504 772 1.18e-125 SMART
low complexity region 813 828 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Tyro3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Tyro3 APN 2 119813200 missense probably damaging 1.00
IGL02221:Tyro3 APN 2 119812590 missense probably benign 0.00
IGL02389:Tyro3 APN 2 119804864 splice site probably benign
IGL02442:Tyro3 APN 2 119808868 missense probably benign 0.16
PIT4382001:Tyro3 UTSW 2 119802364 missense probably damaging 1.00
R0078:Tyro3 UTSW 2 119817006 missense probably damaging 1.00
R0087:Tyro3 UTSW 2 119801701 missense probably benign 0.38
R0503:Tyro3 UTSW 2 119803230 splice site probably benign
R0551:Tyro3 UTSW 2 119816904 missense probably damaging 1.00
R1858:Tyro3 UTSW 2 119801695 missense possibly damaging 0.95
R1902:Tyro3 UTSW 2 119801695 missense possibly damaging 0.73
R1980:Tyro3 UTSW 2 119808817 missense probably benign
R2294:Tyro3 UTSW 2 119805645 missense probably damaging 0.99
R3877:Tyro3 UTSW 2 119813293 missense probably damaging 0.98
R4651:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4652:Tyro3 UTSW 2 119816868 missense probably benign 0.01
R4698:Tyro3 UTSW 2 119803270 missense probably damaging 1.00
R4757:Tyro3 UTSW 2 119810938 missense probably damaging 1.00
R4894:Tyro3 UTSW 2 119802298 missense probably damaging 0.96
R5193:Tyro3 UTSW 2 119810517 missense probably damaging 1.00
R5366:Tyro3 UTSW 2 119804831 missense probably damaging 1.00
R5693:Tyro3 UTSW 2 119810868 missense probably damaging 1.00
R6017:Tyro3 UTSW 2 119816666 missense probably damaging 1.00
R6110:Tyro3 UTSW 2 119812823 missense probably damaging 1.00
R6160:Tyro3 UTSW 2 119803270 missense probably damaging 0.98
R6290:Tyro3 UTSW 2 119816840 missense probably benign
R6293:Tyro3 UTSW 2 119808000 missense possibly damaging 0.89
R6366:Tyro3 UTSW 2 119816675 missense probably damaging 0.96
R6712:Tyro3 UTSW 2 119804854 missense probably null 0.44
Z1088:Tyro3 UTSW 2 119809467 missense probably benign 0.31
Z1177:Tyro3 UTSW 2 119809991 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGAACTGGAGAACATTCTGG -3'
(R):5'- TGTGATCAGACTGGGCCTAGTC -3'

Sequencing Primer
(F):5'- AGAACATTCTGGGCCACCTGTC -3'
(R):5'- TAGTCAGGCAGCACAGCG -3'
Posted On2019-10-24