Incidental Mutation 'R0234:Rbm15b'
ID59047
Institutional Source Beutler Lab
Gene Symbol Rbm15b
Ensembl Gene ENSMUSG00000074102
Gene NameRNA binding motif protein 15B
Synonyms
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R0234 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106880918-106887428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106885364 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 535 (Y535C)
Ref Sequence ENSEMBL: ENSMUSP00000059330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000055843] [ENSMUST00000069036] [ENSMUST00000159283] [ENSMUST00000159645] [ENSMUST00000161758]
PDB Structure
Solution structure of the RNA recognition motif from hypothetical RNA binding protein BC052180 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055009
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000055843
AA Change: Y535C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059330
Gene: ENSMUSG00000074102
AA Change: Y535C

DomainStartEndE-ValueType
low complexity region 5 41 N/A INTRINSIC
low complexity region 53 75 N/A INTRINSIC
low complexity region 78 133 N/A INTRINSIC
RRM 137 212 2.47e-2 SMART
low complexity region 216 251 N/A INTRINSIC
low complexity region 266 299 N/A INTRINSIC
RRM 334 406 2.03e-15 SMART
RRM 415 484 3.57e-11 SMART
low complexity region 653 675 N/A INTRINSIC
Pfam:SPOC 719 854 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069036
SMART Domains Protein: ENSMUSP00000066534
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 13 165 3.2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159283
SMART Domains Protein: ENSMUSP00000124562
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 171 9.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159645
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160503
SMART Domains Protein: ENSMUSP00000124453
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 17 118 1.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160978
SMART Domains Protein: ENSMUSP00000124791
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 124 1.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161272
SMART Domains Protein: ENSMUSP00000125424
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 1 51 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161758
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000185707
AA Change: Y85C
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15B, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Rbm15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Rbm15b APN 9 106885709 missense probably damaging 1.00
IGL02514:Rbm15b APN 9 106884977 missense probably damaging 0.96
IGL02585:Rbm15b APN 9 106885826 missense probably benign 0.22
IGL02814:Rbm15b APN 9 106885776 missense probably benign 0.12
IGL03110:Rbm15b APN 9 106885974 missense probably damaging 1.00
IGL03335:Rbm15b APN 9 106884339 missense probably damaging 0.99
R0004:Rbm15b UTSW 9 106884936 missense probably benign 0.02
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0390:Rbm15b UTSW 9 106885998 missense probably benign 0.03
R1981:Rbm15b UTSW 9 106881623 unclassified probably benign
R2966:Rbm15b UTSW 9 106885592 missense probably damaging 1.00
R4085:Rbm15b UTSW 9 106885737 missense possibly damaging 0.80
R4890:Rbm15b UTSW 9 106885829 missense possibly damaging 0.86
R5081:Rbm15b UTSW 9 106884921 missense probably benign 0.01
R5118:Rbm15b UTSW 9 106886102 missense possibly damaging 0.65
R5513:Rbm15b UTSW 9 106886117 missense probably benign 0.02
R7341:Rbm15b UTSW 9 106885047 missense probably benign 0.35
R7711:Rbm15b UTSW 9 106885943 missense possibly damaging 0.67
R7842:Rbm15b UTSW 9 106885889 missense probably damaging 1.00
R7925:Rbm15b UTSW 9 106885889 missense probably damaging 1.00
X0024:Rbm15b UTSW 9 106885379 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGCACCATGTCTGCTGTTGCTGAG -3'
(R):5'- TGGATTTTGCCAAAGCCGAGGAG -3'

Sequencing Primer
(F):5'- AGTGAGTTGTCCTCCCACG -3'
(R):5'- AGGAGACTCGCTATCCCCAG -3'
Posted On2013-07-11