Incidental Mutation 'R7645:Fbxl4'
ID590470
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22377037 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000042219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect probably damaging
Transcript: ENSMUST00000039234
AA Change: S158P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: S158P

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184455
AA Change: S158P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000184582
AA Change: S158P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: S158P

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185029
AA Change: S158P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410
AA Change: S158P

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 splice site probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
R7106:Fbxl4 UTSW 4 22427140 splice site probably null
R7164:Fbxl4 UTSW 4 22386218 missense probably benign 0.00
R7264:Fbxl4 UTSW 4 22386145 missense possibly damaging 0.94
R7502:Fbxl4 UTSW 4 22376655 missense probably benign
R7666:Fbxl4 UTSW 4 22376869 missense probably benign 0.07
R8152:Fbxl4 UTSW 4 22427225 missense possibly damaging 0.77
R8445:Fbxl4 UTSW 4 22385983 missense not run
Z1176:Fbxl4 UTSW 4 22427280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCTTCCCAAGTTCTGGTG -3'
(R):5'- GTGACTTAAGAGGATGCTGCC -3'

Sequencing Primer
(F):5'- AGTTCTGGTGACTTCACGCAGAC -3'
(R):5'- CTTAAGAGGATGCTGCCAAAAAG -3'
Posted On2019-10-24