Incidental Mutation 'R7645:Rufy3'
ID590475
Institutional Source Beutler Lab
Gene Symbol Rufy3
Ensembl Gene ENSMUSG00000029291
Gene NameRUN and FYVE domain containing 3
SynonymsRpipx, D5Bwg0860e, 2810428M05Rik, 6330416M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location88565040-88651392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88640617 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 506 (T506A)
Ref Sequence ENSEMBL: ENSMUSP00000143770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031229] [ENSMUST00000196686] [ENSMUST00000196894] [ENSMUST00000198965] [ENSMUST00000199312]
Predicted Effect probably benign
Transcript: ENSMUST00000031229
AA Change: T456A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031229
Gene: ENSMUSG00000029291
AA Change: T456A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 163 225 8.08e-23 SMART
coiled coil region 267 329 N/A INTRINSIC
coiled coil region 357 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196686
AA Change: T474A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143209
Gene: ENSMUSG00000029291
AA Change: T474A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196894
AA Change: T506A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143770
Gene: ENSMUSG00000029291
AA Change: T506A

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 8.08e-23 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198965
SMART Domains Protein: ENSMUSP00000143302
Gene: ENSMUSG00000029291

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 84 107 N/A INTRINSIC
RUN 213 275 2.8e-25 SMART
coiled coil region 317 379 N/A INTRINSIC
coiled coil region 407 555 N/A INTRINSIC
FYVE 597 662 2.9e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199312
AA Change: T474A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143115
Gene: ENSMUSG00000029291
AA Change: T474A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RUN 181 243 8.08e-23 SMART
coiled coil region 285 347 N/A INTRINSIC
coiled coil region 375 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RPIP8, UNC-14, and NESCA domain-containing protein that is required for maintenance of neuronal polarity. In addition, it has been implicated in mediation of gastric cancer cell migration and invasion via interaction with P21-activated kinase-1, which promotes its expression. The encoded protein localizes to F-actin-enriched invadopodia to induce formation of protrusions, thereby facilitating cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: The gene product is involved in regulating neuronal polarity and axon growth. Homozygous KO leads to loss of neuronal polarity and causes neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Rufy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Rufy3 APN 5 88621350 missense probably damaging 0.96
IGL01964:Rufy3 APN 5 88615070 missense probably damaging 1.00
IGL02537:Rufy3 APN 5 88640662 utr 3 prime probably benign
R0111:Rufy3 UTSW 5 88630584 missense probably damaging 1.00
R0552:Rufy3 UTSW 5 88584270 missense possibly damaging 0.79
R1441:Rufy3 UTSW 5 88632515 missense probably damaging 0.97
R1565:Rufy3 UTSW 5 88640632 missense probably damaging 1.00
R2507:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R2508:Rufy3 UTSW 5 88649898 missense probably damaging 1.00
R3707:Rufy3 UTSW 5 88643032 missense probably benign 0.28
R4907:Rufy3 UTSW 5 88584192 missense possibly damaging 0.95
R4999:Rufy3 UTSW 5 88637226 missense probably damaging 1.00
R5134:Rufy3 UTSW 5 88645567 missense probably benign 0.01
R5420:Rufy3 UTSW 5 88640659 makesense probably null
R5482:Rufy3 UTSW 5 88637332 frame shift probably null
R6029:Rufy3 UTSW 5 88627255 missense probably damaging 1.00
R6254:Rufy3 UTSW 5 88584309 missense probably benign 0.01
R6444:Rufy3 UTSW 5 88637307 missense probably damaging 1.00
R7219:Rufy3 UTSW 5 88649856 missense probably benign 0.22
R7256:Rufy3 UTSW 5 88614947 missense possibly damaging 0.91
R7327:Rufy3 UTSW 5 88642952 missense probably damaging 0.99
R7352:Rufy3 UTSW 5 88637194 missense possibly damaging 0.92
R7484:Rufy3 UTSW 5 88598472 missense probably benign 0.01
R7953:Rufy3 UTSW 5 88642992 missense probably benign 0.01
R8043:Rufy3 UTSW 5 88642992 missense probably benign 0.01
X0066:Rufy3 UTSW 5 88617418 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCCTCAGTGAGTTTTAACTTGGC -3'
(R):5'- CATACCAAAATTCTAACTCTGGGG -3'

Sequencing Primer
(F):5'- GAGTTTTAACTTGGCATTAAGGCC -3'
(R):5'- CAAAATTCTAACTCTGGGGGTGCG -3'
Posted On2019-10-24