Incidental Mutation 'R7645:Coq2'
ID590476
Institutional Source Beutler Lab
Gene Symbol Coq2
Ensembl Gene ENSMUSG00000029319
Gene Namecoenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Synonyms2310002F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location100654723-100675140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 100660250 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 228 (C228W)
Ref Sequence ENSEMBL: ENSMUSP00000031262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031262] [ENSMUST00000126981] [ENSMUST00000127811] [ENSMUST00000135801]
Predicted Effect probably damaging
Transcript: ENSMUST00000031262
AA Change: C228W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031262
Gene: ENSMUSG00000029319
AA Change: C228W

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Pfam:UbiA 89 348 2.1e-52 PFAM
low complexity region 354 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126981
SMART Domains Protein: ENSMUSP00000122296
Gene: ENSMUSG00000029319

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 55 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127811
Predicted Effect probably benign
Transcript: ENSMUST00000135146
SMART Domains Protein: ENSMUSP00000122631
Gene: ENSMUSG00000029319

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135801
AA Change: C45W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119410
Gene: ENSMUSG00000029319
AA Change: C45W

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions in the final steps in the biosynthesis of CoQ (ubiquinone), a redox carrier in the mitochondrial respiratory chain and a lipid-soluble antioxidant. This enzyme, which is part of the coenzyme Q10 pathway, catalyzes the prenylation of parahydroxybenzoate with an all-trans polyprenyl group. Mutations in this gene cause coenzyme Q10 deficiency, a mitochondrial encephalomyopathy, and also COQ2 nephropathy, an inherited form of mitochondriopathy with primary renal involvement. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Coq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Coq2 APN 5 100655314 missense probably benign 0.00
IGL02987:Coq2 APN 5 100663688 nonsense probably null
R0051:Coq2 UTSW 5 100663685 missense probably benign 0.00
R0051:Coq2 UTSW 5 100663685 missense probably benign 0.00
R0538:Coq2 UTSW 5 100668023 missense possibly damaging 0.89
R1056:Coq2 UTSW 5 100657947 missense probably benign 0.01
R1934:Coq2 UTSW 5 100661865 missense probably damaging 1.00
R4788:Coq2 UTSW 5 100657909 missense probably damaging 0.96
R5071:Coq2 UTSW 5 100667950 missense probably damaging 1.00
R5221:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R5232:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R5233:Coq2 UTSW 5 100657832 missense possibly damaging 0.83
R6301:Coq2 UTSW 5 100661863 missense possibly damaging 0.90
R6450:Coq2 UTSW 5 100661904 utr 3 prime probably benign
R7096:Coq2 UTSW 5 100663720 utr 5 prime probably benign
R7265:Coq2 UTSW 5 100660270 missense possibly damaging 0.89
R7453:Coq2 UTSW 5 100663586 missense probably benign 0.01
R7530:Coq2 UTSW 5 100674142 missense probably benign
R7920:Coq2 UTSW 5 100663875 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGCATTTTAACCTGGTC -3'
(R):5'- CACAAGAGATTGAGAAGATCCTGTG -3'

Sequencing Primer
(F):5'- ACTTGGCCTCACAGTAAGTTTCAGG -3'
(R):5'- TCCTGTGAGGGAAGGACAGAC -3'
Posted On2019-10-24