Incidental Mutation 'R7645:Col6a6'
ID590484
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Namecollagen, type VI, alpha 6
SynonymsE330026B02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105687809-105828160 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105767198 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
Predicted Effect probably null
Transcript: ENSMUST00000098441
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166431
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105758191 critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105782412 missense probably benign 0.04
IGL00917:Col6a6 APN 9 105784254 splice site probably benign
IGL01385:Col6a6 APN 9 105783666 missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105785958 nonsense probably null
IGL01508:Col6a6 APN 9 105727166 splice site probably benign
IGL01668:Col6a6 APN 9 105709271 missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105709255 missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105689626 missense probably benign 0.02
IGL01934:Col6a6 APN 9 105698659 critical splice donor site probably null
IGL01944:Col6a6 APN 9 105783909 missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105780985 missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105767199 critical splice donor site probably null
IGL02129:Col6a6 APN 9 105736340 splice site probably benign
IGL02201:Col6a6 APN 9 105780995 missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105784101 missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105732216 missense probably benign 0.05
IGL02574:Col6a6 APN 9 105782191 missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105727170 critical splice donor site probably null
IGL02852:Col6a6 APN 9 105784073 missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105709452 missense probably benign 0.01
IGL03327:Col6a6 APN 9 105767234 missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105732263 missense probably benign 0.23
R0042:Col6a6 UTSW 9 105780697 missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105748848 splice site probably benign
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105702213 missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105702275 missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105767288 missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105784116 missense probably benign 0.13
R0382:Col6a6 UTSW 9 105755555 missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105784204 missense probably benign 0.02
R0421:Col6a6 UTSW 9 105784206 missense probably benign 0.02
R0502:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0503:Col6a6 UTSW 9 105767351 missense probably benign 0.04
R0600:Col6a6 UTSW 9 105761440 missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105777744 missense probably benign 0.45
R0629:Col6a6 UTSW 9 105727165 splice site probably benign
R0690:Col6a6 UTSW 9 105709486 missense probably benign 0.01
R1155:Col6a6 UTSW 9 105782090 missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105748910 missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105774303 missense probably null 0.98
R1263:Col6a6 UTSW 9 105709489 missense probably benign 0.01
R1296:Col6a6 UTSW 9 105781091 missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105709473 missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105778075 missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105777549 missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105732211 critical splice donor site probably null
R1830:Col6a6 UTSW 9 105702270 missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105781102 missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105709384 missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105780804 missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105754223 missense probably benign 0.01
R3176:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3276:Col6a6 UTSW 9 105786230 missense probably benign 0.01
R3429:Col6a6 UTSW 9 105777967 missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105782174 missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105780692 missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105698879 missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105783956 missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105783690 missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105698949 missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105767342 missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105767424 missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105788948 missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105767198 critical splice donor site probably null
R5002:Col6a6 UTSW 9 105786093 missense probably benign 0.00
R5111:Col6a6 UTSW 9 105709474 missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105782033 missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105709107 missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105774338 missense probably null 0.79
R5491:Col6a6 UTSW 9 105738236 missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105761518 critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105767075 missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105783917 missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105727227 splice site probably null
R6425:Col6a6 UTSW 9 105698865 missense probably benign 0.21
R6464:Col6a6 UTSW 9 105788953 start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105698691 missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105785825 missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105698913 missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105783680 missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105783941 missense probably benign 0.32
R7032:Col6a6 UTSW 9 105767508 missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105783969 missense probably benign 0.00
R7472:Col6a6 UTSW 9 105782423 missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105767324 missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105785744 missense possibly damaging 0.74
R7716:Col6a6 UTSW 9 105783903 missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105689561 missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105780684 nonsense probably null
R8016:Col6a6 UTSW 9 105767528 missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105699020 missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105781947 missense probably benign 0.01
R8082:Col6a6 UTSW 9 105783930 nonsense probably null
R8243:Col6a6 UTSW 9 105699269 missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105784073 missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105755654 missense probably benign 0.25
R8384:Col6a6 UTSW 9 105755694 missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105774796 missense probably damaging 1.00
X0022:Col6a6 UTSW 9 105699332 missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105780952 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105728255 missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105788895 missense probably null 0.24
Predicted Primers PCR Primer
(F):5'- GCAGCCAGAGTTGACTTCTG -3'
(R):5'- TCAAGTGACGAACGCTATGG -3'

Sequencing Primer
(F):5'- CTGAGCTTGAAACCCATTTGG -3'
(R):5'- GGAAAGATACCCTTCCAAGTTTGAG -3'
Posted On2019-10-24