Incidental Mutation 'R7645:Col6a6'
ID 590484
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 045701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R7645 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 105566616-105705413 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105644397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect probably null
Transcript: ENSMUST00000098441
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166431
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,392,789 (GRCm39) C375S probably benign Het
Adgrg3 A G 8: 95,761,392 (GRCm39) probably benign Het
Amn1 C T 6: 149,086,529 (GRCm39) M44I probably benign Het
Atg2b T C 12: 105,589,689 (GRCm39) Y1854C probably benign Het
Bcat2 T A 7: 45,237,387 (GRCm39) N290K probably benign Het
Ccdc39 T C 3: 33,879,318 (GRCm39) probably null Het
Cnot10 T C 9: 114,442,705 (GRCm39) S501G probably benign Het
Coq2 A C 5: 100,808,116 (GRCm39) C228W probably damaging Het
Cpt2 A T 4: 107,764,171 (GRCm39) M531K possibly damaging Het
Dennd1a A G 2: 37,911,375 (GRCm39) L204P probably damaging Het
Dock9 C T 14: 121,835,075 (GRCm39) V1305M probably benign Het
Dusp16 A G 6: 134,702,888 (GRCm39) I201T probably damaging Het
Esco2 T C 14: 66,064,630 (GRCm39) D370G probably benign Het
Fbxl4 T C 4: 22,377,037 (GRCm39) S158P probably damaging Het
Fut10 A G 8: 31,726,232 (GRCm39) H329R possibly damaging Het
Gpr3 A G 4: 132,938,640 (GRCm39) W11R probably damaging Het
H2-M3 T A 17: 37,581,620 (GRCm39) I94N probably damaging Het
Krt7 T C 15: 101,310,524 (GRCm39) I57T probably damaging Het
Ltc4s T C 11: 50,129,373 (GRCm39) probably benign Het
Ms4a6b A T 19: 11,501,304 (GRCm39) T105S probably damaging Het
Muc6 T C 7: 141,234,923 (GRCm39) H592R probably benign Het
Ncam1 T C 9: 49,476,303 (GRCm39) E262G probably benign Het
Or4x11 T A 2: 89,868,091 (GRCm39) I276K possibly damaging Het
Or5b108 T C 19: 13,168,937 (GRCm39) V302A probably benign Het
Plxnb1 T A 9: 108,943,480 (GRCm39) S1908T probably damaging Het
Polg2 A T 11: 106,666,419 (GRCm39) M242K probably benign Het
Polr3g T C 13: 81,842,563 (GRCm39) T151A unknown Het
Pramel51 T C 12: 88,143,028 (GRCm39) T392A probably damaging Het
Psmb8 T C 17: 34,419,186 (GRCm39) L160P possibly damaging Het
Rab5b G A 10: 128,517,260 (GRCm39) A176V possibly damaging Het
Rreb1 T C 13: 38,115,010 (GRCm39) C790R probably damaging Het
Rufy3 A G 5: 88,788,476 (GRCm39) T506A probably benign Het
Samd11 T C 4: 156,340,243 (GRCm39) probably benign Het
Slc12a2 T C 18: 58,029,450 (GRCm39) F279L possibly damaging Het
Slc49a4 T A 16: 35,554,438 (GRCm39) probably null Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,183 (GRCm39) probably benign Het
Srgn C T 10: 62,330,757 (GRCm39) W116* probably null Het
Svil A G 18: 5,099,663 (GRCm39) E1733G probably damaging Het
Tbc1d22a C T 15: 86,119,742 (GRCm39) P49S probably benign Het
Tbc1d9 A T 8: 83,969,182 (GRCm39) K490M probably damaging Het
Tcte1 A G 17: 45,845,915 (GRCm39) N173S probably benign Het
Tmco6 C T 18: 36,868,446 (GRCm39) R31W probably damaging Het
Ttn C A 2: 76,730,025 (GRCm39) A5155S unknown Het
Tyro3 T C 2: 119,647,387 (GRCm39) Y839H probably damaging Het
Zc3h12d A G 10: 7,743,340 (GRCm39) D370G probably benign Het
Zc3h7b T C 15: 81,664,803 (GRCm39) L554P probably damaging Het
Zfp352 C T 4: 90,113,014 (GRCm39) P385S probably benign Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105,635,390 (GRCm39) critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105,659,611 (GRCm39) missense probably benign 0.04
IGL00917:Col6a6 APN 9 105,661,453 (GRCm39) splice site probably benign
IGL01385:Col6a6 APN 9 105,660,865 (GRCm39) missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105,663,157 (GRCm39) nonsense probably null
IGL01508:Col6a6 APN 9 105,604,365 (GRCm39) splice site probably benign
IGL01668:Col6a6 APN 9 105,586,470 (GRCm39) missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105,586,454 (GRCm39) missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105,566,825 (GRCm39) missense probably benign 0.02
IGL01934:Col6a6 APN 9 105,575,858 (GRCm39) critical splice donor site probably null
IGL01944:Col6a6 APN 9 105,661,108 (GRCm39) missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105,658,184 (GRCm39) missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105,644,398 (GRCm39) critical splice donor site probably null
IGL02129:Col6a6 APN 9 105,613,539 (GRCm39) splice site probably benign
IGL02201:Col6a6 APN 9 105,658,194 (GRCm39) missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105,661,300 (GRCm39) missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105,609,415 (GRCm39) missense probably benign 0.05
IGL02574:Col6a6 APN 9 105,659,390 (GRCm39) missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105,604,369 (GRCm39) critical splice donor site probably null
IGL02852:Col6a6 APN 9 105,661,272 (GRCm39) missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105,586,651 (GRCm39) missense probably benign 0.01
IGL03327:Col6a6 APN 9 105,644,433 (GRCm39) missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105,609,462 (GRCm39) missense probably benign 0.23
R0042:Col6a6 UTSW 9 105,657,896 (GRCm39) missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105,626,047 (GRCm39) splice site probably benign
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105,579,474 (GRCm39) missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105,644,487 (GRCm39) missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105,661,315 (GRCm39) missense probably benign 0.13
R0382:Col6a6 UTSW 9 105,632,754 (GRCm39) missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105,661,403 (GRCm39) missense probably benign 0.02
R0421:Col6a6 UTSW 9 105,661,405 (GRCm39) missense probably benign 0.02
R0502:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0503:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0600:Col6a6 UTSW 9 105,638,639 (GRCm39) missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105,654,943 (GRCm39) missense probably benign 0.45
R0629:Col6a6 UTSW 9 105,604,364 (GRCm39) splice site probably benign
R0690:Col6a6 UTSW 9 105,586,685 (GRCm39) missense probably benign 0.01
R1155:Col6a6 UTSW 9 105,659,289 (GRCm39) missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105,626,109 (GRCm39) missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105,651,502 (GRCm39) missense probably null 0.98
R1263:Col6a6 UTSW 9 105,586,688 (GRCm39) missense probably benign 0.01
R1296:Col6a6 UTSW 9 105,658,290 (GRCm39) missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105,586,672 (GRCm39) missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105,655,274 (GRCm39) missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105,654,748 (GRCm39) missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105,609,410 (GRCm39) critical splice donor site probably null
R1830:Col6a6 UTSW 9 105,579,469 (GRCm39) missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105,658,301 (GRCm39) missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105,586,583 (GRCm39) missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105,658,003 (GRCm39) missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105,631,422 (GRCm39) missense probably benign 0.01
R3176:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3276:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3429:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105,659,373 (GRCm39) missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105,657,891 (GRCm39) missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105,576,078 (GRCm39) missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105,661,155 (GRCm39) missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105,660,889 (GRCm39) missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105,576,148 (GRCm39) missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105,644,541 (GRCm39) missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105,644,623 (GRCm39) missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105,666,147 (GRCm39) missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R5002:Col6a6 UTSW 9 105,663,292 (GRCm39) missense probably benign 0.00
R5111:Col6a6 UTSW 9 105,586,673 (GRCm39) missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105,659,232 (GRCm39) missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105,586,306 (GRCm39) missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105,651,537 (GRCm39) missense probably null 0.79
R5491:Col6a6 UTSW 9 105,615,435 (GRCm39) missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105,638,717 (GRCm39) critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105,644,274 (GRCm39) missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105,661,116 (GRCm39) missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105,604,426 (GRCm39) splice site probably null
R6425:Col6a6 UTSW 9 105,576,064 (GRCm39) missense probably benign 0.21
R6464:Col6a6 UTSW 9 105,666,152 (GRCm39) start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105,575,890 (GRCm39) missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105,663,024 (GRCm39) missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105,576,112 (GRCm39) missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105,660,879 (GRCm39) missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105,661,140 (GRCm39) missense probably benign 0.32
R7032:Col6a6 UTSW 9 105,644,707 (GRCm39) missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105,661,168 (GRCm39) missense probably benign 0.00
R7472:Col6a6 UTSW 9 105,659,622 (GRCm39) missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105,644,523 (GRCm39) missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R7716:Col6a6 UTSW 9 105,661,102 (GRCm39) missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105,566,760 (GRCm39) missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105,657,883 (GRCm39) nonsense probably null
R8016:Col6a6 UTSW 9 105,644,727 (GRCm39) missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105,576,219 (GRCm39) missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105,659,146 (GRCm39) missense probably benign 0.01
R8082:Col6a6 UTSW 9 105,661,129 (GRCm39) nonsense probably null
R8243:Col6a6 UTSW 9 105,576,468 (GRCm39) missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105,661,272 (GRCm39) missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105,632,853 (GRCm39) missense probably benign 0.25
R8384:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105,651,995 (GRCm39) missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105,651,987 (GRCm39) missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105,663,348 (GRCm39) missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105,644,528 (GRCm39) missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105,586,745 (GRCm39) missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105,661,276 (GRCm39) missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105,659,169 (GRCm39) missense probably benign 0.30
R9225:Col6a6 UTSW 9 105,659,437 (GRCm39) missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105,651,757 (GRCm39) missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105,663,172 (GRCm39) missense probably benign 0.00
R9360:Col6a6 UTSW 9 105,644,686 (GRCm39) missense probably benign 0.00
R9368:Col6a6 UTSW 9 105,663,300 (GRCm39) missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105,651,825 (GRCm39) missense probably benign 0.40
R9450:Col6a6 UTSW 9 105,661,373 (GRCm39) missense probably benign
R9454:Col6a6 UTSW 9 105,661,059 (GRCm39) missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105,586,361 (GRCm39) missense probably benign 0.01
R9563:Col6a6 UTSW 9 105,572,952 (GRCm39) missense probably benign 0.02
R9568:Col6a6 UTSW 9 105,657,926 (GRCm39) missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105,616,401 (GRCm39) missense probably benign 0.07
R9664:Col6a6 UTSW 9 105,658,254 (GRCm39) missense probably benign 0.11
R9747:Col6a6 UTSW 9 105,661,239 (GRCm39) missense probably benign 0.29
R9760:Col6a6 UTSW 9 105,659,253 (GRCm39) missense probably damaging 0.99
X0022:Col6a6 UTSW 9 105,576,531 (GRCm39) missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105,658,151 (GRCm39) missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105,666,094 (GRCm39) missense probably null 0.24
Z1177:Col6a6 UTSW 9 105,605,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCCAGAGTTGACTTCTG -3'
(R):5'- TCAAGTGACGAACGCTATGG -3'

Sequencing Primer
(F):5'- CTGAGCTTGAAACCCATTTGG -3'
(R):5'- GGAAAGATACCCTTCCAAGTTTGAG -3'
Posted On 2019-10-24