Incidental Mutation 'R7645:Plxnb1'
List |< first << previous [record 28 of 48] next >> last >|
ID590485
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109114412 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1908 (S1908T)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: S1908T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: S1908T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 109100718 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 splice site probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 splice site probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 splice site probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 109100175 missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7428:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7443:Plxnb1 UTSW 9 109114607 missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 109100861 missense probably damaging 0.99
R7680:Plxnb1 UTSW 9 109100503 nonsense probably null
R7866:Plxnb1 UTSW 9 109100457 missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 109114340 missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 109109232 missense probably damaging 1.00
R8092:Plxnb1 UTSW 9 109100505 missense probably damaging 1.00
R8150:Plxnb1 UTSW 9 109112078 missense probably damaging 0.98
R8286:Plxnb1 UTSW 9 109106802 missense probably damaging 1.00
R8290:Plxnb1 UTSW 9 109109619 missense probably benign 0.00
Z1177:Plxnb1 UTSW 9 109108921 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCATGTGAGGCACTAAGCTC -3'
(R):5'- TGGAACAGGTCATCCACAAACTTC -3'

Sequencing Primer
(F):5'- AAGCTCTTACATCTTGGCACAGGG -3'
(R):5'- GGTCATCCACAAACTTCTGCAGTG -3'
Posted On2019-10-24