Incidental Mutation 'R7645:Cnot10'
ID 590486
Institutional Source Beutler Lab
Gene Symbol Cnot10
Ensembl Gene ENSMUSG00000056167
Gene Name CCR4-NOT transcription complex, subunit 10
Synonyms
MMRRC Submission 045701-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7645 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 114585878-114640184 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114613637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 501 (S501G)
Ref Sequence ENSEMBL: ENSMUSP00000064840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000215155] [ENSMUST00000216785] [ENSMUST00000217148]
AlphaFold Q8BH15
Predicted Effect probably benign
Transcript: ENSMUST00000070117
AA Change: S501G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167
AA Change: S501G

DomainStartEndE-ValueType
Blast:TPR 27 60 2e-10 BLAST
coiled coil region 73 107 N/A INTRINSIC
TPR 110 143 4.32e1 SMART
low complexity region 182 198 N/A INTRINSIC
TPR 293 326 3.37e-2 SMART
TPR 355 388 6.75e1 SMART
low complexity region 496 508 N/A INTRINSIC
TPR 643 676 7.87e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215155
Predicted Effect probably benign
Transcript: ENSMUST00000216785
Predicted Effect probably benign
Transcript: ENSMUST00000217148
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Cnot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Cnot10 APN 9 114631855 missense probably benign 0.19
IGL02004:Cnot10 APN 9 114622930 missense probably damaging 1.00
IGL03297:Cnot10 APN 9 114598716 missense possibly damaging 0.87
BB003:Cnot10 UTSW 9 114617815 missense probably damaging 1.00
BB013:Cnot10 UTSW 9 114617815 missense probably damaging 1.00
R0348:Cnot10 UTSW 9 114598770 missense probably benign 0.10
R0390:Cnot10 UTSW 9 114629150 nonsense probably null
R1256:Cnot10 UTSW 9 114610681 missense probably damaging 1.00
R1471:Cnot10 UTSW 9 114591551 missense probably benign 0.00
R1607:Cnot10 UTSW 9 114629095 nonsense probably null
R1721:Cnot10 UTSW 9 114614999 missense probably benign
R1741:Cnot10 UTSW 9 114597824 missense possibly damaging 0.87
R2116:Cnot10 UTSW 9 114626436 missense probably damaging 1.00
R4073:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4074:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4075:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4365:Cnot10 UTSW 9 114631881 nonsense probably null
R4383:Cnot10 UTSW 9 114631881 nonsense probably null
R4385:Cnot10 UTSW 9 114631881 nonsense probably null
R4398:Cnot10 UTSW 9 114631881 nonsense probably null
R4423:Cnot10 UTSW 9 114617920 missense probably damaging 1.00
R4859:Cnot10 UTSW 9 114627464 missense probably damaging 1.00
R4916:Cnot10 UTSW 9 114629134 missense possibly damaging 0.72
R4927:Cnot10 UTSW 9 114617944 missense probably damaging 1.00
R5153:Cnot10 UTSW 9 114613735 missense probably damaging 1.00
R5677:Cnot10 UTSW 9 114629093 missense probably damaging 1.00
R5702:Cnot10 UTSW 9 114629010 missense probably damaging 0.98
R5790:Cnot10 UTSW 9 114625917 splice site probably null
R6190:Cnot10 UTSW 9 114632723 missense probably damaging 1.00
R6353:Cnot10 UTSW 9 114597546 missense probably damaging 1.00
R6463:Cnot10 UTSW 9 114625902 missense probably damaging 1.00
R6819:Cnot10 UTSW 9 114615055 missense probably benign 0.10
R6849:Cnot10 UTSW 9 114631936 missense probably benign 0.01
R6875:Cnot10 UTSW 9 114615107 missense probably benign 0.00
R7071:Cnot10 UTSW 9 114617719 splice site probably null
R7408:Cnot10 UTSW 9 114631826 missense probably benign 0.33
R7412:Cnot10 UTSW 9 114625903 missense probably damaging 1.00
R7706:Cnot10 UTSW 9 114593438 missense probably damaging 0.98
R7926:Cnot10 UTSW 9 114617815 missense probably damaging 1.00
R8187:Cnot10 UTSW 9 114597488 nonsense probably null
R8322:Cnot10 UTSW 9 114627469 missense probably damaging 0.99
R8412:Cnot10 UTSW 9 114610670 missense probably benign 0.11
R8904:Cnot10 UTSW 9 114601355 missense probably benign 0.06
R9340:Cnot10 UTSW 9 114631829 missense probably benign 0.01
R9691:Cnot10 UTSW 9 114591647 missense probably damaging 1.00
X0062:Cnot10 UTSW 9 114615134 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCGATCAAGACCTTGCC -3'
(R):5'- CTTTGAAGTGATGGTCAGTCTTCAG -3'

Sequencing Primer
(F):5'- TTGAGTAAGAATGGCCCCCTTAGAC -3'
(R):5'- AGCCATTCCTGTAGCCAGTGTG -3'
Posted On 2019-10-24