Incidental Mutation 'R7645:Zc3h12d'
ID590487
Institutional Source Beutler Lab
Gene Symbol Zc3h12d
Ensembl Gene ENSMUSG00000039981
Gene Namezinc finger CCCH type containing 12D
SynonymsD730019B10Rik, TFL
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7645 (G1)
Quality Score213.009
Status Not validated
Chromosome10
Chromosomal Location7832470-7870396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7867576 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 370 (D370G)
Ref Sequence ENSEMBL: ENSMUSP00000040217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039484]
Predicted Effect probably benign
Transcript: ENSMUST00000039484
AA Change: D370G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040217
Gene: ENSMUSG00000039981
AA Change: D370G

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 91 247 4e-67 PFAM
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disrupted regulation of excessive inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Zc3h12d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zc3h12d APN 10 7862467 missense probably damaging 1.00
IGL01013:Zc3h12d APN 10 7839956 missense probably damaging 1.00
IGL02090:Zc3h12d APN 10 7867332 missense probably benign 0.00
IGL02876:Zc3h12d APN 10 7862600 missense probably damaging 0.99
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0040:Zc3h12d UTSW 10 7867914 missense probably benign 0.02
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R0242:Zc3h12d UTSW 10 7862566 missense probably damaging 1.00
R1942:Zc3h12d UTSW 10 7853313 missense probably damaging 1.00
R2290:Zc3h12d UTSW 10 7867459 missense probably benign 0.00
R2354:Zc3h12d UTSW 10 7867938 missense probably benign 0.00
R4816:Zc3h12d UTSW 10 7867947 missense probably damaging 1.00
R4932:Zc3h12d UTSW 10 7853250 missense probably damaging 0.99
R5191:Zc3h12d UTSW 10 7867818 missense possibly damaging 0.51
R5384:Zc3h12d UTSW 10 7853250 missense probably damaging 1.00
R5396:Zc3h12d UTSW 10 7866326 missense probably damaging 1.00
R6409:Zc3h12d UTSW 10 7867318 missense probably benign 0.04
R6877:Zc3h12d UTSW 10 7839971 missense probably damaging 0.99
R6903:Zc3h12d UTSW 10 7867661 missense probably benign
R6967:Zc3h12d UTSW 10 7839880 missense probably damaging 1.00
R7312:Zc3h12d UTSW 10 7867581 missense probably benign 0.00
R7594:Zc3h12d UTSW 10 7862618 missense probably damaging 1.00
R7622:Zc3h12d UTSW 10 7867269 missense probably damaging 1.00
R7769:Zc3h12d UTSW 10 7867626 missense probably benign 0.03
R7864:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
R7947:Zc3h12d UTSW 10 7839959 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAGTGCAGATTCTACCACCC -3'
(R):5'- ACTGTGCATGTCCCTGGAAC -3'

Sequencing Primer
(F):5'- TGTCTGTGGCCGACGAACTC -3'
(R):5'- ATGTCCCTGGAACGGTGTCTC -3'
Posted On2019-10-24