Incidental Mutation 'R7645:Polg2'
List |< first << previous [record 29 of 48] next >> last >|
ID590491
Institutional Source Beutler Lab
Gene Symbol Polg2
Ensembl Gene ENSMUSG00000020718
Gene Namepolymerase (DNA directed), gamma 2, accessory subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106768253-106779537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106775593 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 242 (M242K)
Ref Sequence ENSEMBL: ENSMUSP00000021060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000021062] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000134029] [ENSMUST00000155107]
PDB Structure
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021060
AA Change: M242K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718
AA Change: M242K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021062
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126201
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the processivity subunit of the mitochondrial DNA polymerase gamma. The encoded protein forms a heterotrimer containing one catalytic subunit and two processivity subunits. This protein enhances DNA binding and promotes processive DNA synthesis. Mutations in this gene result in autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and turning, fail to initiate turning, lack mt-Co1 activity, and contain abnormal mitochondria with reduced mtDNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Polg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Polg2 APN 11 106777432 splice site probably null
IGL02205:Polg2 APN 11 106779120 missense probably benign 0.09
IGL02850:Polg2 APN 11 106768467 missense probably damaging 1.00
IGL02952:Polg2 APN 11 106772713 missense possibly damaging 0.78
IGL03328:Polg2 APN 11 106768337 missense probably benign 0.40
IGL02835:Polg2 UTSW 11 106775440 missense probably benign
R0109:Polg2 UTSW 11 106777132 splice site probably benign
R0143:Polg2 UTSW 11 106777526 missense probably benign 0.01
R0709:Polg2 UTSW 11 106768413 missense probably damaging 1.00
R1385:Polg2 UTSW 11 106768323 missense probably damaging 0.97
R1938:Polg2 UTSW 11 106778961 missense probably damaging 0.98
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R3159:Polg2 UTSW 11 106768337 missense probably benign 0.40
R3776:Polg2 UTSW 11 106779284 missense probably benign 0.01
R3982:Polg2 UTSW 11 106779202 nonsense probably null
R5306:Polg2 UTSW 11 106778970 missense probably damaging 0.98
R5338:Polg2 UTSW 11 106779238 missense possibly damaging 0.95
R7055:Polg2 UTSW 11 106777214 missense probably damaging 1.00
R7146:Polg2 UTSW 11 106772746 missense probably benign 0.01
R7464:Polg2 UTSW 11 106773714 missense probably benign 0.08
Z1176:Polg2 UTSW 11 106773429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGGTAAAGAACGTGTGG -3'
(R):5'- TGTTGCTGGATAAAAGTCTCAGGC -3'

Sequencing Primer
(F):5'- GGAGCTCGGGGTGACATAC -3'
(R):5'- GTCTCAGGCAACCTTAATTCTCAGAG -3'
Posted On2019-10-24