Incidental Mutation 'R7645:Gm10436'
List |< first << previous [record 18 of 48] next >> last >|
ID590492
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7645 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88176258 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 392 (T392A)
Ref Sequence ENSEMBL: ENSMUSP00000071508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect probably damaging
Transcript: ENSMUST00000071580
AA Change: T392A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: T392A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220521
AA Change: T197A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably benign
Transcript: ENSMUST00000222081
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect probably benign
Transcript: ENSMUST00000222556
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Krt7 T C 15: 101,412,643 I57T probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1279:Gm10436 UTSW 12 88175880 missense probably benign 0.42
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R2412:Gm10436 UTSW 12 88177110 missense probably damaging 0.98
R3040:Gm10436 UTSW 12 88178348 missense probably benign 0.00
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5601:Gm10436 UTSW 12 88176047 missense probably damaging 1.00
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
R6656:Gm10436 UTSW 12 88175993 missense possibly damaging 0.89
R7307:Gm10436 UTSW 12 88181749 missense probably damaging 1.00
R7332:Gm10436 UTSW 12 88176417 missense possibly damaging 0.72
R7544:Gm10436 UTSW 12 88176080 missense probably benign 0.00
R7569:Gm10436 UTSW 12 88176315 missense probably benign
R7752:Gm10436 UTSW 12 88175999 missense probably damaging 1.00
R7855:Gm10436 UTSW 12 88176083 missense probably benign 0.03
R7860:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R8113:Gm10436 UTSW 12 88177080 missense probably benign 0.00
R8356:Gm10436 UTSW 12 88177216 missense probably benign 0.01
R8456:Gm10436 UTSW 12 88177216 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGGGGCAGGGTAACACTC -3'
(R):5'- AAAGCAAGCATTTCTTCTCTACCC -3'

Sequencing Primer
(F):5'- GGGTAACACTCATAGATCAGCTGAC -3'
(R):5'- GTGCCTGAAAAAGCCCTTG -3'
Posted On2019-10-24