Mutagenetix > Incidental Mutations

Incidental Mutation 'R7645:Atg2b'

590493

Institutional Source

Beutler Lab

Gene Symbol

Atg2b

Ensembl Gene

ENSMUSG00000041341

Gene Name

autophagy related 2B

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R7645 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105616136-105685211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105623430 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1854 (Y1854C)

Ref Sequence

ENSEMBL: ENSMUSP00000037441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041055]

Predicted Effect

probably benign
Transcript: ENSMUST00000041055
AA Change: Y1854C

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: Y1854C

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	11	127	3.5e-19	PFAM
low complexity region	286	298	N/A	INTRINSIC
low complexity region	409	428	N/A	INTRINSIC
low complexity region	864	870	N/A	INTRINSIC
low complexity region	893	904	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
Pfam:ATG_C	1976	2071	1.4e-33	PFAM

Predicted Effect

Meta Mutation Damage Score

0.0714

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	T	A	13: 111,256,255	C375S	probably benign	Het
Adgrg3	A	G	8: 95,034,764		probably benign	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Bcat2	T	A	7: 45,587,963	N290K	probably benign	Het
Ccdc39	T	C	3: 33,825,169		probably null	Het
Cnot10	T	C	9: 114,613,637	S501G	probably benign	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Coq2	A	C	5: 100,660,250	C228W	probably damaging	Het
Cpt2	A	T	4: 107,906,974	M531K	possibly damaging	Het
Dennd1a	A	G	2: 38,021,363	L204P	probably damaging	Het
Dirc2	T	A	16: 35,734,068		probably null	Het
Dock9	C	T	14: 121,597,663	V1305M	probably benign	Het
Dusp16	A	G	6: 134,725,925	I201T	probably damaging	Het
Esco2	T	C	14: 65,827,181	D370G	probably benign	Het
Fbxl4	T	C	4: 22,377,037	S158P	probably damaging	Het
Fut10	A	G	8: 31,236,204	H329R	possibly damaging	Het
Gm10436	T	C	12: 88,176,258	T392A	probably damaging	Het
Gpr3	A	G	4: 133,211,329	W11R	probably damaging	Het
H2-M3	T	A	17: 37,270,729	I94N	probably damaging	Het
Krt7	T	C	15: 101,412,643	I57T	probably damaging	Het
Ltc4s	T	C	11: 50,238,546		probably benign	Het
Ms4a6b	A	T	19: 11,523,940	T105S	probably damaging	Het
Muc6	T	C	7: 141,648,658	H592R	probably benign	Het
Ncam1	T	C	9: 49,565,003	E262G	probably benign	Het
Olfr1265	T	A	2: 90,037,747	I276K	possibly damaging	Het
Olfr1462	T	C	19: 13,191,573	V302A	probably benign	Het
Plxnb1	T	A	9: 109,114,412	S1908T	probably damaging	Het
Polg2	A	T	11: 106,775,593	M242K	probably benign	Het
Polr3g	T	C	13: 81,694,444	T151A	unknown	Het
Psmb8	T	C	17: 34,200,212	L160P	possibly damaging	Het
Rab5b	G	A	10: 128,681,391	A176V	possibly damaging	Het
Rreb1	T	C	13: 37,931,034	C790R	probably damaging	Het
Rufy3	A	G	5: 88,640,617	T506A	probably benign	Het
Samd11	T	C	4: 156,255,183		probably benign	Het
Slc12a2	T	C	18: 57,896,378	F279L	possibly damaging	Het
Son	TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,295		probably benign	Het
Srgn	C	T	10: 62,494,978	W116*	probably null	Het
Svil	A	G	18: 5,099,663	E1733G	probably damaging	Het
Tbc1d22a	C	T	15: 86,235,541	P49S	probably benign	Het
Tbc1d9	A	T	8: 83,242,553	K490M	probably damaging	Het
Tcte1	A	G	17: 45,534,989	N173S	probably benign	Het
Tmco6	C	T	18: 36,735,393	R31W	probably damaging	Het
Ttn	C	A	2: 76,899,681	A5155S	unknown	Het
Tyro3	T	C	2: 119,816,906	Y839H	probably damaging	Het
Zc3h12d	A	G	10: 7,867,576	D370G	probably benign	Het
Zc3h7b	T	C	15: 81,780,602	L554P	probably damaging	Het
Zfp352	C	T	4: 90,224,777	P385S	probably benign	Het

Other mutations in Atg2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Atg2b	APN	12	105644916	missense	probably benign	0.20
IGL01326:Atg2b	APN	12	105622144	missense	probably damaging	1.00
IGL02063:Atg2b	APN	12	105648322	missense	possibly damaging	0.89
IGL02260:Atg2b	APN	12	105636440	splice site	probably benign
IGL02376:Atg2b	APN	12	105645468	missense	probably damaging	1.00
IGL02381:Atg2b	APN	12	105648348	missense	probably damaging	1.00
IGL02434:Atg2b	APN	12	105639207	missense	probably benign	0.00
IGL02534:Atg2b	APN	12	105643267	missense	probably damaging	1.00
IGL03011:Atg2b	APN	12	105626362	missense	probably damaging	0.98
IGL03173:Atg2b	APN	12	105658294	missense	possibly damaging	0.68
R6669_atg2b_067	UTSW	12	105671529	missense	possibly damaging	0.90
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0511:Atg2b	UTSW	12	105617153	missense	probably damaging	1.00
R0762:Atg2b	UTSW	12	105674970	missense	possibly damaging	0.56
R0786:Atg2b	UTSW	12	105636508	missense	probably benign	0.00
R1029:Atg2b	UTSW	12	105635773	missense	probably damaging	0.96
R1529:Atg2b	UTSW	12	105661133	missense	probably benign
R1563:Atg2b	UTSW	12	105623488	missense	probably damaging	0.99
R1746:Atg2b	UTSW	12	105669329	missense	possibly damaging	0.79
R1887:Atg2b	UTSW	12	105654092	missense	probably benign	0.01
R1956:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R1957:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R2272:Atg2b	UTSW	12	105638008	missense	probably benign	0.00
R2877:Atg2b	UTSW	12	105664009	nonsense	probably null
R2878:Atg2b	UTSW	12	105664009	nonsense	probably null
R4798:Atg2b	UTSW	12	105652629	missense	probably benign	0.37
R4836:Atg2b	UTSW	12	105646814	missense	probably benign
R5007:Atg2b	UTSW	12	105643876	splice site	probably null
R5042:Atg2b	UTSW	12	105621262	missense	probably benign	0.01
R5134:Atg2b	UTSW	12	105674950	missense	probably damaging	0.96
R5212:Atg2b	UTSW	12	105646796	missense	probably benign	0.00
R5250:Atg2b	UTSW	12	105635765	missense	probably damaging	1.00
R5307:Atg2b	UTSW	12	105658329	missense	probably benign	0.17
R5342:Atg2b	UTSW	12	105658916	missense	possibly damaging	0.90
R5583:Atg2b	UTSW	12	105649155	missense	possibly damaging	0.94
R5656:Atg2b	UTSW	12	105621328	missense	probably benign	0.00
R5660:Atg2b	UTSW	12	105649124	nonsense	probably null
R5903:Atg2b	UTSW	12	105639359	missense	possibly damaging	0.90
R6018:Atg2b	UTSW	12	105661171	missense	probably damaging	0.96
R6153:Atg2b	UTSW	12	105623482	missense	possibly damaging	0.80
R6326:Atg2b	UTSW	12	105661092	nonsense	probably null
R6584:Atg2b	UTSW	12	105657995	missense	probably damaging	1.00
R6593:Atg2b	UTSW	12	105644848	missense	probably damaging	1.00
R6669:Atg2b	UTSW	12	105671529	missense	possibly damaging	0.90
R6847:Atg2b	UTSW	12	105635788	missense	probably damaging	1.00
R7003:Atg2b	UTSW	12	105654249	missense	probably benign	0.01
R7193:Atg2b	UTSW	12	105664708	missense	probably damaging	1.00
R7387:Atg2b	UTSW	12	105622775	missense	probably damaging	1.00
R7432:Atg2b	UTSW	12	105661204	missense	probably damaging	0.98
R7432:Atg2b	UTSW	12	105664698	missense	probably benign	0.08
R7630:Atg2b	UTSW	12	105646954	critical splice acceptor site	probably null
R7634:Atg2b	UTSW	12	105652120	missense	probably damaging	1.00
R7653:Atg2b	UTSW	12	105636472	missense	possibly damaging	0.68
X0018:Atg2b	UTSW	12	105666697	missense	possibly damaging	0.86
X0066:Atg2b	UTSW	12	105646785	missense	probably benign	0.12
Z1177:Atg2b	UTSW	12	105635764	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTCTGTTCCAGTCACAAGC -3'
(R):5'- AGCTGATATGATGGGTTGCAC -3'

Sequencing Primer
(F):5'- TCTGTTCCAGTCACAAGCAAACAC -3'
(R):5'- TGTTTCTCTTCATTAAAGAATGTTGC -3'

Posted On

2019-10-24