Incidental Mutation 'R7645:Esco2'
ID 590497
Institutional Source Beutler Lab
Gene Symbol Esco2
Ensembl Gene ENSMUSG00000022034
Gene Name establishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms 2410004I17Rik, D030072L07Rik
MMRRC Submission 045701-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7645 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 66056476-66071418 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66064630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 370 (D370G)
Ref Sequence ENSEMBL: ENSMUSP00000022613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022613] [ENSMUST00000225853]
AlphaFold Q8CIB9
Predicted Effect probably benign
Transcript: ENSMUST00000022613
AA Change: D370G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034
AA Change: D370G

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225853
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation associated with impaired chromosome cohesion and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,392,789 (GRCm39) C375S probably benign Het
Adgrg3 A G 8: 95,761,392 (GRCm39) probably benign Het
Amn1 C T 6: 149,086,529 (GRCm39) M44I probably benign Het
Atg2b T C 12: 105,589,689 (GRCm39) Y1854C probably benign Het
Bcat2 T A 7: 45,237,387 (GRCm39) N290K probably benign Het
Ccdc39 T C 3: 33,879,318 (GRCm39) probably null Het
Cnot10 T C 9: 114,442,705 (GRCm39) S501G probably benign Het
Col6a6 A G 9: 105,644,397 (GRCm39) probably null Het
Coq2 A C 5: 100,808,116 (GRCm39) C228W probably damaging Het
Cpt2 A T 4: 107,764,171 (GRCm39) M531K possibly damaging Het
Dennd1a A G 2: 37,911,375 (GRCm39) L204P probably damaging Het
Dock9 C T 14: 121,835,075 (GRCm39) V1305M probably benign Het
Dusp16 A G 6: 134,702,888 (GRCm39) I201T probably damaging Het
Fbxl4 T C 4: 22,377,037 (GRCm39) S158P probably damaging Het
Fut10 A G 8: 31,726,232 (GRCm39) H329R possibly damaging Het
Gpr3 A G 4: 132,938,640 (GRCm39) W11R probably damaging Het
H2-M3 T A 17: 37,581,620 (GRCm39) I94N probably damaging Het
Krt7 T C 15: 101,310,524 (GRCm39) I57T probably damaging Het
Ltc4s T C 11: 50,129,373 (GRCm39) probably benign Het
Ms4a6b A T 19: 11,501,304 (GRCm39) T105S probably damaging Het
Muc6 T C 7: 141,234,923 (GRCm39) H592R probably benign Het
Ncam1 T C 9: 49,476,303 (GRCm39) E262G probably benign Het
Or4x11 T A 2: 89,868,091 (GRCm39) I276K possibly damaging Het
Or5b108 T C 19: 13,168,937 (GRCm39) V302A probably benign Het
Plxnb1 T A 9: 108,943,480 (GRCm39) S1908T probably damaging Het
Polg2 A T 11: 106,666,419 (GRCm39) M242K probably benign Het
Polr3g T C 13: 81,842,563 (GRCm39) T151A unknown Het
Pramel51 T C 12: 88,143,028 (GRCm39) T392A probably damaging Het
Psmb8 T C 17: 34,419,186 (GRCm39) L160P possibly damaging Het
Rab5b G A 10: 128,517,260 (GRCm39) A176V possibly damaging Het
Rreb1 T C 13: 38,115,010 (GRCm39) C790R probably damaging Het
Rufy3 A G 5: 88,788,476 (GRCm39) T506A probably benign Het
Samd11 T C 4: 156,340,243 (GRCm39) probably benign Het
Slc12a2 T C 18: 58,029,450 (GRCm39) F279L possibly damaging Het
Slc49a4 T A 16: 35,554,438 (GRCm39) probably null Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,183 (GRCm39) probably benign Het
Srgn C T 10: 62,330,757 (GRCm39) W116* probably null Het
Svil A G 18: 5,099,663 (GRCm39) E1733G probably damaging Het
Tbc1d22a C T 15: 86,119,742 (GRCm39) P49S probably benign Het
Tbc1d9 A T 8: 83,969,182 (GRCm39) K490M probably damaging Het
Tcte1 A G 17: 45,845,915 (GRCm39) N173S probably benign Het
Tmco6 C T 18: 36,868,446 (GRCm39) R31W probably damaging Het
Ttn C A 2: 76,730,025 (GRCm39) A5155S unknown Het
Tyro3 T C 2: 119,647,387 (GRCm39) Y839H probably damaging Het
Zc3h12d A G 10: 7,743,340 (GRCm39) D370G probably benign Het
Zc3h7b T C 15: 81,664,803 (GRCm39) L554P probably damaging Het
Zfp352 C T 4: 90,113,014 (GRCm39) P385S probably benign Het
Other mutations in Esco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Esco2 APN 14 66,063,977 (GRCm39) missense probably benign 0.00
IGL01613:Esco2 APN 14 66,064,044 (GRCm39) missense possibly damaging 0.75
IGL02148:Esco2 APN 14 66,064,044 (GRCm39) missense probably benign 0.00
IGL03039:Esco2 APN 14 66,068,867 (GRCm39) missense probably damaging 0.97
PIT4508001:Esco2 UTSW 14 66,068,914 (GRCm39) missense probably damaging 0.99
R0400:Esco2 UTSW 14 66,069,155 (GRCm39) missense possibly damaging 0.73
R0894:Esco2 UTSW 14 66,064,726 (GRCm39) missense probably benign 0.35
R1778:Esco2 UTSW 14 66,068,711 (GRCm39) missense possibly damaging 0.47
R1795:Esco2 UTSW 14 66,064,726 (GRCm39) missense probably benign 0.35
R1962:Esco2 UTSW 14 66,068,982 (GRCm39) missense probably damaging 1.00
R2325:Esco2 UTSW 14 66,064,027 (GRCm39) splice site probably null
R2357:Esco2 UTSW 14 66,064,000 (GRCm39) missense probably benign 0.32
R2369:Esco2 UTSW 14 66,059,189 (GRCm39) missense probably damaging 1.00
R4659:Esco2 UTSW 14 66,064,035 (GRCm39) missense possibly damaging 0.92
R5648:Esco2 UTSW 14 66,068,641 (GRCm39) missense probably damaging 1.00
R5873:Esco2 UTSW 14 66,061,640 (GRCm39) missense probably benign 0.00
R6782:Esco2 UTSW 14 66,057,465 (GRCm39) missense probably benign 0.00
R6877:Esco2 UTSW 14 66,068,494 (GRCm39) missense probably benign 0.01
R7116:Esco2 UTSW 14 66,064,006 (GRCm39) missense probably damaging 1.00
R7572:Esco2 UTSW 14 66,068,641 (GRCm39) missense probably damaging 0.97
R8055:Esco2 UTSW 14 66,069,168 (GRCm39) missense probably benign 0.20
R8072:Esco2 UTSW 14 66,070,130 (GRCm39) missense probably benign
R8483:Esco2 UTSW 14 66,069,118 (GRCm39) missense probably benign 0.00
R9244:Esco2 UTSW 14 66,059,088 (GRCm39) missense probably damaging 1.00
R9478:Esco2 UTSW 14 66,068,657 (GRCm39) nonsense probably null
R9498:Esco2 UTSW 14 66,068,752 (GRCm39) missense probably benign 0.00
R9728:Esco2 UTSW 14 66,069,069 (GRCm39) missense probably benign
Z1177:Esco2 UTSW 14 66,062,385 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCCAAAACTATGAGCTCC -3'
(R):5'- CTGTCAGTCAGCTCTGGATTTG -3'

Sequencing Primer
(F):5'- CTATGAGCTCCAAAGTACTGGCTAG -3'
(R):5'- GGCACTGAATTTACTCATTGTGTTC -3'
Posted On 2019-10-24