Mutagenetix > Incidental Mutations

Incidental Mutation 'R7645:Zc3h7b'

590499

Institutional Source

Beutler Lab

Gene Symbol

Zc3h7b

Ensembl Gene

ENSMUSG00000022390

Gene Name

zinc finger CCCH type containing 7B

Synonyms

Scrg3

MMRRC Submission

Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R7645 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81745057-81796260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81780602 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 554 (L554P)

Ref Sequence

ENSEMBL: ENSMUSP00000105181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109554
AA Change: L554P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: L554P

Domain	Start	End	E-Value	Type
Pfam:TPR_11	34	113	2.3e-12	PFAM
Pfam:TPR_1	82	115	2.4e-6	PFAM
Pfam:TPR_8	82	115	8.2e-4	PFAM
Pfam:TPR_8	116	143	4.8e-3	PFAM
low complexity region	294	309	N/A	INTRINSIC
low complexity region	340	354	N/A	INTRINSIC
ZnF_C3H1	482	508	2.15e1	SMART
ZnF_C3H1	612	638	2.03e1	SMART
ZnF_C3H1	757	782	8.31e0	SMART
ZnF_C2H2	843	867	2.86e-1	SMART
ZnF_C3H1	889	914	7.81e-1	SMART
low complexity region	959	981	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	T	A	13: 111,256,255	C375S	probably benign	Het
Adgrg3	A	G	8: 95,034,764		probably benign	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Atg2b	T	C	12: 105,623,430	Y1854C	probably benign	Het
Bcat2	T	A	7: 45,587,963	N290K	probably benign	Het
Ccdc39	T	C	3: 33,825,169		probably null	Het
Cnot10	T	C	9: 114,613,637	S501G	probably benign	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Coq2	A	C	5: 100,660,250	C228W	probably damaging	Het
Cpt2	A	T	4: 107,906,974	M531K	possibly damaging	Het
Dennd1a	A	G	2: 38,021,363	L204P	probably damaging	Het
Dirc2	T	A	16: 35,734,068		probably null	Het
Dock9	C	T	14: 121,597,663	V1305M	probably benign	Het
Dusp16	A	G	6: 134,725,925	I201T	probably damaging	Het
Esco2	T	C	14: 65,827,181	D370G	probably benign	Het
Fbxl4	T	C	4: 22,377,037	S158P	probably damaging	Het
Fut10	A	G	8: 31,236,204	H329R	possibly damaging	Het
Gm10436	T	C	12: 88,176,258	T392A	probably damaging	Het
Gpr3	A	G	4: 133,211,329	W11R	probably damaging	Het
H2-M3	T	A	17: 37,270,729	I94N	probably damaging	Het
Krt7	T	C	15: 101,412,643	I57T	probably damaging	Het
Ltc4s	T	C	11: 50,238,546		probably benign	Het
Ms4a6b	A	T	19: 11,523,940	T105S	probably damaging	Het
Muc6	T	C	7: 141,648,658	H592R	probably benign	Het
Ncam1	T	C	9: 49,565,003	E262G	probably benign	Het
Olfr1265	T	A	2: 90,037,747	I276K	possibly damaging	Het
Olfr1462	T	C	19: 13,191,573	V302A	probably benign	Het
Plxnb1	T	A	9: 109,114,412	S1908T	probably damaging	Het
Polg2	A	T	11: 106,775,593	M242K	probably benign	Het
Polr3g	T	C	13: 81,694,444	T151A	unknown	Het
Psmb8	T	C	17: 34,200,212	L160P	possibly damaging	Het
Rab5b	G	A	10: 128,681,391	A176V	possibly damaging	Het
Rreb1	T	C	13: 37,931,034	C790R	probably damaging	Het
Rufy3	A	G	5: 88,640,617	T506A	probably benign	Het
Samd11	T	C	4: 156,255,183		probably benign	Het
Slc12a2	T	C	18: 57,896,378	F279L	possibly damaging	Het
Son	TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,295		probably benign	Het
Srgn	C	T	10: 62,494,978	W116*	probably null	Het
Svil	A	G	18: 5,099,663	E1733G	probably damaging	Het
Tbc1d22a	C	T	15: 86,235,541	P49S	probably benign	Het
Tbc1d9	A	T	8: 83,242,553	K490M	probably damaging	Het
Tcte1	A	G	17: 45,534,989	N173S	probably benign	Het
Tmco6	C	T	18: 36,735,393	R31W	probably damaging	Het
Ttn	C	A	2: 76,899,681	A5155S	unknown	Het
Tyro3	T	C	2: 119,816,906	Y839H	probably damaging	Het
Zc3h12d	A	G	10: 7,867,576	D370G	probably benign	Het
Zfp352	C	T	4: 90,224,777	P385S	probably benign	Het

Other mutations in Zc3h7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01726:Zc3h7b	APN	15	81771799	missense	possibly damaging	0.95
IGL01955:Zc3h7b	APN	15	81792004	missense	probably benign	0.10
IGL02526:Zc3h7b	APN	15	81793137	missense	probably benign	0.10
IGL02582:Zc3h7b	APN	15	81769140	missense	probably benign	0.05
IGL02736:Zc3h7b	APN	15	81791974	missense	probably benign	0.02
F6893:Zc3h7b	UTSW	15	81778671	missense	possibly damaging	0.94
R0212:Zc3h7b	UTSW	15	81776328	missense	probably benign	0.00
R0242:Zc3h7b	UTSW	15	81768830	splice site	probably benign
R0471:Zc3h7b	UTSW	15	81781968	missense	probably damaging	1.00
R0590:Zc3h7b	UTSW	15	81776998	missense	possibly damaging	0.74
R1530:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1563:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1565:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1566:Zc3h7b	UTSW	15	81768834	missense	possibly damaging	0.91
R1670:Zc3h7b	UTSW	15	81777067	missense	probably benign
R1712:Zc3h7b	UTSW	15	81777088	missense	probably benign
R1727:Zc3h7b	UTSW	15	81768029	missense	probably damaging	1.00
R2069:Zc3h7b	UTSW	15	81792328	missense	probably damaging	0.98
R2375:Zc3h7b	UTSW	15	81792502	missense	probably benign	0.17
R2656:Zc3h7b	UTSW	15	81780430	missense	probably damaging	1.00
R4660:Zc3h7b	UTSW	15	81792250	missense	probably benign	0.07
R4764:Zc3h7b	UTSW	15	81769183	critical splice donor site	probably null
R4815:Zc3h7b	UTSW	15	81793663	missense	probably damaging	1.00
R4999:Zc3h7b	UTSW	15	81779133	missense	probably damaging	1.00
R5086:Zc3h7b	UTSW	15	81793174	missense	probably damaging	0.96
R5169:Zc3h7b	UTSW	15	81773314	missense	probably benign	0.01
R5395:Zc3h7b	UTSW	15	81772501	missense	possibly damaging	0.50
R5407:Zc3h7b	UTSW	15	81785891	missense	probably damaging	0.99
R5587:Zc3h7b	UTSW	15	81771858	missense	possibly damaging	0.80
R5721:Zc3h7b	UTSW	15	81773298	missense	probably benign	0.02
R6001:Zc3h7b	UTSW	15	81792035	missense	possibly damaging	0.89
R6151:Zc3h7b	UTSW	15	81778710	critical splice donor site	probably null
R6248:Zc3h7b	UTSW	15	81783185	missense	probably damaging	1.00
R6397:Zc3h7b	UTSW	15	81792854	missense	probably benign	0.03
R6502:Zc3h7b	UTSW	15	81769051	missense	probably benign	0.01
R7248:Zc3h7b	UTSW	15	81771787	missense	possibly damaging	0.46
R7397:Zc3h7b	UTSW	15	81769153	missense	possibly damaging	0.50
R7450:Zc3h7b	UTSW	15	81783080	missense	probably benign
R7471:Zc3h7b	UTSW	15	81780481	missense	probably damaging	1.00
R7575:Zc3h7b	UTSW	15	81777885	nonsense	probably null
R7650:Zc3h7b	UTSW	15	81793650	missense	possibly damaging	0.81
R7881:Zc3h7b	UTSW	15	81780478	missense	probably damaging	1.00
R7918:Zc3h7b	UTSW	15	81768988	missense	probably damaging	0.98
R8001:Zc3h7b	UTSW	15	81779260	nonsense	probably null
R8504:Zc3h7b	UTSW	15	81780518	missense	not run

Predicted Primers

PCR Primer
(F):5'- TACGGGGATAACTGCACCTTC -3'
(R):5'- TAAATCCTGCACATTCCGGGC -3'

Sequencing Primer
(F):5'- TCGCCTACCATCAGGAGGAGATC -3'
(R):5'- ATTCCGGGCTCCCAAGGAAG -3'

Posted On

2019-10-24