Incidental Mutation 'R7645:Krt7'
List |< first << previous [record 21 of 48] next >> last >|
ID590501
Institutional Source Beutler Lab
Gene Symbol Krt7
Ensembl Gene ENSMUSG00000023039
Gene Namekeratin 7
SynonymsCytokeratin 7, D15Wsu77e, Krt2-7, K7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7645 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101411043-101430313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101412643 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 57 (I57T)
Ref Sequence ENSEMBL: ENSMUSP00000069900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068904] [ENSMUST00000147662]
Predicted Effect probably damaging
Transcript: ENSMUST00000068904
AA Change: I57T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069900
Gene: ENSMUSG00000023039
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Pfam:Keratin_2_head 43 81 3.2e-12 PFAM
Filament 84 396 1.95e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147662
SMART Domains Protein: ENSMUSP00000117046
Gene: ENSMUSG00000023039

DomainStartEndE-ValueType
Pfam:Filament 1 115 4e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation of urothelial cells without histological evidence of hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 T A 13: 111,256,255 C375S probably benign Het
Adgrg3 A G 8: 95,034,764 probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Atg2b T C 12: 105,623,430 Y1854C probably benign Het
Bcat2 T A 7: 45,587,963 N290K probably benign Het
Ccdc39 T C 3: 33,825,169 probably null Het
Cnot10 T C 9: 114,613,637 S501G probably benign Het
Col6a6 A G 9: 105,767,198 probably null Het
Coq2 A C 5: 100,660,250 C228W probably damaging Het
Cpt2 A T 4: 107,906,974 M531K possibly damaging Het
Dennd1a A G 2: 38,021,363 L204P probably damaging Het
Dirc2 T A 16: 35,734,068 probably null Het
Dock9 C T 14: 121,597,663 V1305M probably benign Het
Dusp16 A G 6: 134,725,925 I201T probably damaging Het
Esco2 T C 14: 65,827,181 D370G probably benign Het
Fbxl4 T C 4: 22,377,037 S158P probably damaging Het
Fut10 A G 8: 31,236,204 H329R possibly damaging Het
Gm10436 T C 12: 88,176,258 T392A probably damaging Het
Gpr3 A G 4: 133,211,329 W11R probably damaging Het
H2-M3 T A 17: 37,270,729 I94N probably damaging Het
Ltc4s T C 11: 50,238,546 probably benign Het
Ms4a6b A T 19: 11,523,940 T105S probably damaging Het
Muc6 T C 7: 141,648,658 H592R probably benign Het
Ncam1 T C 9: 49,565,003 E262G probably benign Het
Olfr1265 T A 2: 90,037,747 I276K possibly damaging Het
Olfr1462 T C 19: 13,191,573 V302A probably benign Het
Plxnb1 T A 9: 109,114,412 S1908T probably damaging Het
Polg2 A T 11: 106,775,593 M242K probably benign Het
Polr3g T C 13: 81,694,444 T151A unknown Het
Psmb8 T C 17: 34,200,212 L160P possibly damaging Het
Rab5b G A 10: 128,681,391 A176V possibly damaging Het
Rreb1 T C 13: 37,931,034 C790R probably damaging Het
Rufy3 A G 5: 88,640,617 T506A probably benign Het
Samd11 T C 4: 156,255,183 probably benign Het
Slc12a2 T C 18: 57,896,378 F279L possibly damaging Het
Son TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,295 probably benign Het
Srgn C T 10: 62,494,978 W116* probably null Het
Svil A G 18: 5,099,663 E1733G probably damaging Het
Tbc1d22a C T 15: 86,235,541 P49S probably benign Het
Tbc1d9 A T 8: 83,242,553 K490M probably damaging Het
Tcte1 A G 17: 45,534,989 N173S probably benign Het
Tmco6 C T 18: 36,735,393 R31W probably damaging Het
Ttn C A 2: 76,899,681 A5155S unknown Het
Tyro3 T C 2: 119,816,906 Y839H probably damaging Het
Zc3h12d A G 10: 7,867,576 D370G probably benign Het
Zc3h7b T C 15: 81,780,602 L554P probably damaging Het
Zfp352 C T 4: 90,224,777 P385S probably benign Het
Other mutations in Krt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Krt7 APN 15 101427085 unclassified probably benign
IGL01025:Krt7 APN 15 101423421 missense probably benign 0.17
IGL02229:Krt7 APN 15 101427616 missense probably benign 0.09
IGL03366:Krt7 APN 15 101427610 missense possibly damaging 0.87
R0256:Krt7 UTSW 15 101423309 nonsense probably null
R1648:Krt7 UTSW 15 101412567 missense probably damaging 1.00
R1696:Krt7 UTSW 15 101423426 missense probably benign 0.01
R1779:Krt7 UTSW 15 101423409 missense probably damaging 1.00
R1837:Krt7 UTSW 15 101419582 missense probably benign 0.42
R2045:Krt7 UTSW 15 101423484 splice site probably null
R2510:Krt7 UTSW 15 101412657 missense probably benign 0.01
R2511:Krt7 UTSW 15 101412657 missense probably benign 0.01
R4041:Krt7 UTSW 15 101423280 splice site probably null
R4729:Krt7 UTSW 15 101420558 missense probably benign 0.03
R4964:Krt7 UTSW 15 101413972 missense probably damaging 1.00
R5032:Krt7 UTSW 15 101412547 missense probably benign 0.00
R6023:Krt7 UTSW 15 101412397 intron probably benign
R6270:Krt7 UTSW 15 101419558 missense probably damaging 1.00
R7019:Krt7 UTSW 15 101413970 missense probably damaging 1.00
R7773:Krt7 UTSW 15 101414032 missense possibly damaging 0.49
R7844:Krt7 UTSW 15 101412634 missense possibly damaging 0.80
X0026:Krt7 UTSW 15 101412772 missense probably damaging 0.98
Z1177:Krt7 UTSW 15 101423467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCGCTATGTCCATCCAC -3'
(R):5'- CATTTGTTGGCAGAGCGGAG -3'

Sequencing Primer
(F):5'- GCTATGTCCATCCACTTCAGC -3'
(R):5'- GGAGAAGTACTATACAGAGCCCAC -3'
Posted On2019-10-24