Mutagenetix > Incidental Mutations

Incidental Mutation 'R7645:Son'

590503

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7645 (G1)

Quality Score

212.468

Status

Not validated

Chromosome

Chromosomal Location

91647506-91679221 bp(+) (GRCm38)

Type of Mutation

small deletion (14 aa in frame mutation)

DNA Base Change (assembly)

TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG at 91660295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

probably benign
Transcript: ENSMUST00000114036

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114037

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117633

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119368

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140312

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	T	A	13: 111,256,255	C375S	probably benign	Het
Adgrg3	A	G	8: 95,034,764		probably benign	Het
Amn1	C	T	6: 149,185,031	M44I	probably benign	Het
Atg2b	T	C	12: 105,623,430	Y1854C	probably benign	Het
Bcat2	T	A	7: 45,587,963	N290K	probably benign	Het
Ccdc39	T	C	3: 33,825,169		probably null	Het
Cnot10	T	C	9: 114,613,637	S501G	probably benign	Het
Col6a6	A	G	9: 105,767,198		probably null	Het
Coq2	A	C	5: 100,660,250	C228W	probably damaging	Het
Cpt2	A	T	4: 107,906,974	M531K	possibly damaging	Het
Dennd1a	A	G	2: 38,021,363	L204P	probably damaging	Het
Dirc2	T	A	16: 35,734,068		probably null	Het
Dock9	C	T	14: 121,597,663	V1305M	probably benign	Het
Dusp16	A	G	6: 134,725,925	I201T	probably damaging	Het
Esco2	T	C	14: 65,827,181	D370G	probably benign	Het
Fbxl4	T	C	4: 22,377,037	S158P	probably damaging	Het
Fut10	A	G	8: 31,236,204	H329R	possibly damaging	Het
Gm10436	T	C	12: 88,176,258	T392A	probably damaging	Het
Gpr3	A	G	4: 133,211,329	W11R	probably damaging	Het
H2-M3	T	A	17: 37,270,729	I94N	probably damaging	Het
Krt7	T	C	15: 101,412,643	I57T	probably damaging	Het
Ltc4s	T	C	11: 50,238,546		probably benign	Het
Ms4a6b	A	T	19: 11,523,940	T105S	probably damaging	Het
Muc6	T	C	7: 141,648,658	H592R	probably benign	Het
Ncam1	T	C	9: 49,565,003	E262G	probably benign	Het
Olfr1265	T	A	2: 90,037,747	I276K	possibly damaging	Het
Olfr1462	T	C	19: 13,191,573	V302A	probably benign	Het
Plxnb1	T	A	9: 109,114,412	S1908T	probably damaging	Het
Polg2	A	T	11: 106,775,593	M242K	probably benign	Het
Polr3g	T	C	13: 81,694,444	T151A	unknown	Het
Psmb8	T	C	17: 34,200,212	L160P	possibly damaging	Het
Rab5b	G	A	10: 128,681,391	A176V	possibly damaging	Het
Rreb1	T	C	13: 37,931,034	C790R	probably damaging	Het
Rufy3	A	G	5: 88,640,617	T506A	probably benign	Het
Samd11	T	C	4: 156,255,183		probably benign	Het
Slc12a2	T	C	18: 57,896,378	F279L	possibly damaging	Het
Srgn	C	T	10: 62,494,978	W116*	probably null	Het
Svil	A	G	18: 5,099,663	E1733G	probably damaging	Het
Tbc1d22a	C	T	15: 86,235,541	P49S	probably benign	Het
Tbc1d9	A	T	8: 83,242,553	K490M	probably damaging	Het
Tcte1	A	G	17: 45,534,989	N173S	probably benign	Het
Tmco6	C	T	18: 36,735,393	R31W	probably damaging	Het
Ttn	C	A	2: 76,899,681	A5155S	unknown	Het
Tyro3	T	C	2: 119,816,906	Y839H	probably damaging	Het
Zc3h12d	A	G	10: 7,867,576	D370G	probably benign	Het
Zc3h7b	T	C	15: 81,780,602	L554P	probably damaging	Het
Zfp352	C	T	4: 90,224,777	P385S	probably benign	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91664322	missense	probably damaging	0.99
IGL01024:Son	APN	16	91655910	missense	probably damaging	1.00
IGL01066:Son	APN	16	91660136	intron	probably benign
IGL01083:Son	APN	16	91657391	missense	probably damaging	1.00
IGL01115:Son	APN	16	91659458	missense	probably benign	0.31
IGL01467:Son	APN	16	91657277	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91657286	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91658015	missense	probably benign	0.00
IGL02156:Son	APN	16	91656104	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91658795	missense	probably damaging	0.99
IGL02498:Son	APN	16	91656825	missense	probably damaging	0.99
IGL02517:Son	APN	16	91655211	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91658471	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91651752	missense	probably damaging	1.00
IGL03180:Son	APN	16	91657008	missense	probably damaging	1.00
R0013:Son	UTSW	16	91651662	missense	probably damaging	1.00
R0036:Son	UTSW	16	91660166	intron	probably benign
R0037:Son	UTSW	16	91664728	missense	probably damaging	1.00
R0041:Son	UTSW	16	91659333	missense	probably damaging	1.00
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91658977	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91678155	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91656873	missense	probably damaging	0.99
R0256:Son	UTSW	16	91656584	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91656144	missense	probably damaging	1.00
R0815:Son	UTSW	16	91655484	missense	probably damaging	0.98
R1225:Son	UTSW	16	91657340	missense	probably damaging	1.00
R1255:Son	UTSW	16	91664695	missense	probably damaging	1.00
R1457:Son	UTSW	16	91657086	missense	probably damaging	1.00
R1459:Son	UTSW	16	91655342	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91659734	missense	probably damaging	0.99
R1587:Son	UTSW	16	91659718	missense	probably damaging	1.00
R1605:Son	UTSW	16	91657664	missense	probably damaging	1.00
R1629:Son	UTSW	16	91657622	missense	probably damaging	1.00
R1711:Son	UTSW	16	91660226	intron	probably benign
R2138:Son	UTSW	16	91659372	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91647960	splice site	probably null
R2351:Son	UTSW	16	91657659	missense	probably damaging	0.98
R2434:Son	UTSW	16	91654687	missense	probably damaging	1.00
R2870:Son	UTSW	16	91664317	splice site	probably null
R2871:Son	UTSW	16	91664317	splice site	probably null
R2872:Son	UTSW	16	91664317	splice site	probably null
R2889:Son	UTSW	16	91659899	unclassified	probably benign
R3712:Son	UTSW	16	91656726	missense	probably damaging	0.99
R3913:Son	UTSW	16	91660111	intron	probably benign
R4172:Son	UTSW	16	91659362	missense	probably damaging	1.00
R4301:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91658411	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91658868	missense	probably damaging	0.96
R4881:Son	UTSW	16	91675509	missense	probably benign	0.31
R5020:Son	UTSW	16	91656375	missense	probably damaging	1.00
R5032:Son	UTSW	16	91657664	missense	probably damaging	1.00
R5151:Son	UTSW	16	91655699	missense	probably damaging	1.00
R5153:Son	UTSW	16	91655022	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91656675	missense	probably damaging	0.99
R5243:Son	UTSW	16	91654733	missense	probably damaging	1.00
R5354:Son	UTSW	16	91655739	missense	probably damaging	0.99
R5529:Son	UTSW	16	91655466	missense	probably damaging	1.00
R5696:Son	UTSW	16	91671413	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91657490	missense	probably damaging	1.00
R5766:Son	UTSW	16	91664987	intron	probably benign
R5788:Son	UTSW	16	91660052	intron	probably benign
R5992:Son	UTSW	16	91658904	missense	probably benign	0.04
R6314:Son	UTSW	16	91660410	intron	probably benign
R6371:Son	UTSW	16	91674741
R6429:Son	UTSW	16	91658166	missense	probably benign	0.33
R6451:Son	UTSW	16	91657602	missense	probably damaging	0.99
R6489:Son	UTSW	16	91655156	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91659947	intron	probably benign
R6753:Son	UTSW	16	91657188	missense	probably damaging	0.99
R6916:Son	UTSW	16	91654785	missense	probably damaging	0.97
R7070:Son	UTSW	16	91656841	unclassified	probably benign
R7079:Son	UTSW	16	91656841	unclassified	probably benign
R7110:Son	UTSW	16	91656518	missense	probably benign	0.01
R7120:Son	UTSW	16	91656691	unclassified	probably benign
R7120:Son	UTSW	16	91670526	missense	unknown
R7167:Son	UTSW	16	91660334	small deletion	probably benign
R7205:Son	UTSW	16	91660295	small deletion	probably benign
R7208:Son	UTSW	16	91662102	missense	unknown
R7219:Son	UTSW	16	91665001	missense	unknown
R7249:Son	UTSW	16	91660334	small deletion	probably benign
R7328:Son	UTSW	16	91658390	missense	probably benign	0.33
R7330:Son	UTSW	16	91656598	unclassified	probably benign
R7374:Son	UTSW	16	91660334	small deletion	probably benign
R7405:Son	UTSW	16	91656691	unclassified	probably benign
R7420:Son	UTSW	16	91660334	small deletion	probably benign
R7424:Son	UTSW	16	91660334	small deletion	probably benign
R7464:Son	UTSW	16	91656691	unclassified	probably benign
R7514:Son	UTSW	16	91654860	missense	probably damaging	0.99
R7555:Son	UTSW	16	91658922	missense	probably damaging	0.99
R7716:Son	UTSW	16	91656691	unclassified	probably benign
R7718:Son	UTSW	16	91660334	small deletion	probably benign
R7778:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7824:Son	UTSW	16	91656528	missense	probably damaging	0.99
R7856:Son	UTSW	16	91659258	missense	probably damaging	0.99
R7870:Son	UTSW	16	91656598	unclassified	probably benign
R7928:Son	UTSW	16	91656841	unclassified	probably benign
R7972:Son	UTSW	16	91660334	small deletion	probably benign
R7978:Son	UTSW	16	91660334	small deletion	probably benign
R8000:Son	UTSW	16	91660334	small deletion	probably benign
R8192:Son	UTSW	16	91655549	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8227:Son	UTSW	16	91656691	unclassified	probably benign
R8233:Son	UTSW	16	91660334	small deletion	probably benign
R8255:Son	UTSW	16	91664936	missense	unknown
R8292:Son	UTSW	16	91656657	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91660334	small deletion	probably benign
R8468:Son	UTSW	16	91656691	unclassified	probably benign
R8495:Son	UTSW	16	91660295	small deletion	probably benign
R8772:Son	UTSW	16	91657938	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91660334	small deletion	probably benign
R8862:Son	UTSW	16	91656846	missense	probably damaging	1.00
R8962:Son	UTSW	16	91658169	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91660334	small deletion	probably benign
R8991:Son	UTSW	16	91656478	missense	probably benign	0.04
R8991:Son	UTSW	16	91656720	missense	possibly damaging	0.95
R9031:Son	UTSW	16	91656598	unclassified	probably benign
R9086:Son	UTSW	16	91670530	missense	unknown
R9138:Son	UTSW	16	91655118	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91656691	unclassified	probably benign
R9241:Son	UTSW	16	91657234	missense	probably damaging	0.96
R9258:Son	UTSW	16	91677682	missense	unknown
R9328:Son	UTSW	16	91655757	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91657620	missense	probably damaging	0.98
RF007:Son	UTSW	16	91659369	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91656691	unclassified	probably benign
Z1176:Son	UTSW	16	91655801	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GTCTAGAGGAAGACGGTCTGTATC -3'
(R):5'- ATCGCCTTAATCTGACCGGTG -3'

Sequencing Primer
(F):5'- CGGTCTGTATCAAAAGAGAAACGC -3'
(R):5'- CTGACCGGTGATATACTGAAGCTTC -3'

Posted On

2019-10-24